Incidental Mutation 'R1905:Mre11a'
ID214290
Institutional Source Beutler Lab
Gene Symbol Mre11a
Ensembl Gene ENSMUSG00000031928
Gene NameMRE11A homolog A, double strand break repair nuclease
Synonyms
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1905 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14784654-14837123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 14799627 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 206 (D206N)
Ref Sequence ENSEMBL: ENSMUSP00000111295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034405] [ENSMUST00000115632] [ENSMUST00000147305]
Predicted Effect probably benign
Transcript: ENSMUST00000034405
AA Change: D206N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034405
Gene: ENSMUSG00000031928
AA Change: D206N

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 6.3e-15 PFAM
Mre11_DNA_bind 294 462 1.72e-70 SMART
coiled coil region 487 519 N/A INTRINSIC
low complexity region 566 594 N/A INTRINSIC
low complexity region 683 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115632
AA Change: D206N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111295
Gene: ENSMUSG00000031928
AA Change: D206N

DomainStartEndE-ValueType
Pfam:Metallophos 13 249 1.1e-31 PFAM
Mre11_DNA_bind 294 435 7.6e-49 SMART
coiled coil region 460 492 N/A INTRINSIC
low complexity region 539 567 N/A INTRINSIC
low complexity region 656 672 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136568
SMART Domains Protein: ENSMUSP00000121012
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
PDB:3T1I|D 1 107 1e-70 PDB
SCOP:d1ii7a_ 3 107 7e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147305
SMART Domains Protein: ENSMUSP00000116321
Gene: ENSMUSG00000031928

DomainStartEndE-ValueType
Pfam:Metallophos 13 199 1.2e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147676
AA Change: D35N
SMART Domains Protein: ENSMUSP00000119999
Gene: ENSMUSG00000031928
AA Change: D35N

DomainStartEndE-ValueType
PDB:3T1I|D 2 50 3e-26 PDB
Mre11_DNA_bind 62 170 1.81e-32 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein involved in homologous recombination, telomere length maintenance, and DNA double-strand break repair. By itself, the protein has 3' to 5' exonuclease activity and endonuclease activity. The protein forms a complex with the RAD50 homolog; this complex is required for nonhomologous joining of DNA ends and possesses increased single-stranded DNA endonuclease and 3' to 5' exonuclease activities. In conjunction with a DNA ligase, this protein promotes the joining of noncomplementary ends in vitro using short homologies near the ends of the DNA fragments. This gene has a pseudogene on chromosome 3. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Though mutation of this locus affected chromosome stability, mutant mice were no more susceptible to tumorigenesis than wild-type mice. Mutant female mice showed reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Mre11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Mre11a APN 9 14825208 missense probably benign 0.28
IGL00429:Mre11a APN 9 14802813 missense probably damaging 1.00
IGL00922:Mre11a APN 9 14799588 missense probably damaging 1.00
IGL01095:Mre11a APN 9 14809824 missense probably benign
IGL01294:Mre11a APN 9 14830915 missense probably damaging 0.97
IGL01871:Mre11a APN 9 14811897 missense possibly damaging 0.95
IGL02194:Mre11a APN 9 14815209 missense possibly damaging 0.70
IGL02213:Mre11a APN 9 14811884 missense probably damaging 1.00
IGL02245:Mre11a APN 9 14815276 unclassified probably benign
IGL02749:Mre11a APN 9 14826591 missense possibly damaging 0.78
IGL02812:Mre11a APN 9 14790670 unclassified probably null
R0050:Mre11a UTSW 9 14830973 splice site probably benign
R0594:Mre11a UTSW 9 14815209 missense probably benign 0.00
R1241:Mre11a UTSW 9 14799639 missense probably damaging 1.00
R2030:Mre11a UTSW 9 14795805 missense probably damaging 1.00
R2270:Mre11a UTSW 9 14815174 missense probably benign 0.00
R2511:Mre11a UTSW 9 14795769 critical splice acceptor site probably null
R2851:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2852:Mre11a UTSW 9 14826547 missense probably benign 0.00
R2853:Mre11a UTSW 9 14826547 missense probably benign 0.00
R3765:Mre11a UTSW 9 14809847 missense probably benign 0.25
R4612:Mre11a UTSW 9 14802903 missense probably damaging 1.00
R5007:Mre11a UTSW 9 14809820 missense probably benign 0.10
R5343:Mre11a UTSW 9 14811834 missense probably damaging 0.98
R5679:Mre11a UTSW 9 14786919 missense probably damaging 0.99
R5834:Mre11a UTSW 9 14799657 missense probably benign 0.15
R5914:Mre11a UTSW 9 14811936 missense probably damaging 1.00
R5935:Mre11a UTSW 9 14786962 missense probably damaging 1.00
R6089:Mre11a UTSW 9 14819464 missense probably benign 0.02
R6393:Mre11a UTSW 9 14785509 start codon destroyed probably null 0.00
R6625:Mre11a UTSW 9 14805391 missense possibly damaging 0.52
R7248:Mre11a UTSW 9 14811913 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCACAGGGAGTTCCTTTATTTCTCC -3'
(R):5'- AAAACGGAGAGCCCCACTTG -3'

Sequencing Primer
(F):5'- TCCTGATTGCTAAATGGAAAGCGTG -3'
(R):5'- ACTTGAATCCATCATCCTGGTG -3'
Posted On2014-07-14