Incidental Mutation 'R1905:Srebf1'
ID214306
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Namesterol regulatory element binding transcription factor 1
SynonymsSREBP-1a, SREBP-1c, ADD-1, SREBP1c, SREBP-1, bHLHd1, SREBP1
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1905 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location60199089-60222581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60204493 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 400 (D400G)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000144942]
Predicted Effect probably damaging
Transcript: ENSMUST00000020846
AA Change: D424G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: D424G

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129869
Predicted Effect unknown
Transcript: ENSMUST00000134660
AA Change: D365G
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: D365G

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141161
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: D400G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: D400G

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185099
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60204131 missense probably benign 0.01
IGL02097:Srebf1 APN 11 60202824 missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60201713 critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60220458 missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60207076 synonymous silent
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0550:Srebf1 UTSW 11 60201676 missense probably benign 0.00
R0654:Srebf1 UTSW 11 60204116 missense probably benign
R0707:Srebf1 UTSW 11 60204116 missense probably benign
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1584:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1899:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1900:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60206502 missense probably benign
R2191:Srebf1 UTSW 11 60220539 missense probably damaging 1.00
R2267:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R2268:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60210358 utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60207104 missense possibly damaging 0.82
R6371:Srebf1 UTSW 11 60203515 missense probably damaging 1.00
R6376:Srebf1 UTSW 11 60203535 missense probably null 0.19
R7009:Srebf1 UTSW 11 60200526 missense probably damaging 1.00
R7029:Srebf1 UTSW 11 60206984 missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60205867 missense probably benign 0.03
X0017:Srebf1 UTSW 11 60202881 missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60203427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGATTGCAGGTCAGACAC -3'
(R):5'- AGAACCATCCAAGTCCTGGC -3'

Sequencing Primer
(F):5'- CATGCCTCGGCTGTGTGAAG -3'
(R):5'- ATCCAAGTCCTGGCGCTTG -3'
Posted On2014-07-14