Incidental Mutation 'R1905:Foxn1'
ID214308
Institutional Source Beutler Lab
Gene Symbol Foxn1
Ensembl Gene ENSMUSG00000002057
Gene Nameforkhead box N1
Synonymswhn, D11Bhm185e, Hfh11
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1905 (G1)
Quality Score224
Status Validated
Chromosome11
Chromosomal Location78357577-78386558 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 78371810 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108294]
Predicted Effect probably null
Transcript: ENSMUST00000108294
SMART Domains Protein: ENSMUSP00000103929
Gene: ENSMUSG00000002057

DomainStartEndE-ValueType
FH 269 361 2.43e-45 SMART
low complexity region 392 409 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 558 586 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Meta Mutation Damage Score 0.6516 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: The protein encoded by this gene is part of the forkhead family or "winged-helix" transcription factors that are important in developmental processes, immune system regulation, metabolism, cancer and aging. This gene family has over 100 members, subdivided into classes (A-Q) based on phylogeny. The encoded protein is proposed to regulate development of the thymus and differentiation of keratinocytes. Mutations in this gene cause severe primary T-cell immunodeficiency and congenital alopecia. In mouse mutations of this gene underlie the phenotype of the nude mouse, which has been widely used as a model system in oncology, immunology, dermatology, and transplantation studies. In humans mutations in this gene have been correlated with T-cell immunodeficiency, the skin disorder congenital alopecia, and nail dystrophy. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for different mutations have in genetically determined absence or loss of hair and failed hair keratinization, premature lethality (differing by genetic background) and absence of thymus, resulting in multiple immune abnormalities. Heterozygotes have enlarged thymuses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncoa1 A G 12: 4,295,433 V638A probably damaging Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Foxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00900:Foxn1 APN 11 78371283 missense probably benign 0.24
IGL01391:Foxn1 APN 11 78361494 missense probably damaging 1.00
IGL01737:Foxn1 APN 11 78360906 missense possibly damaging 0.81
IGL02669:Foxn1 APN 11 78371160 missense probably damaging 0.99
IGL03276:Foxn1 APN 11 78371124 missense probably benign 0.16
R0200:Foxn1 UTSW 11 78361040 missense probably damaging 1.00
R0639:Foxn1 UTSW 11 78371144 missense possibly damaging 0.67
R0739:Foxn1 UTSW 11 78358999 missense probably benign 0.01
R1112:Foxn1 UTSW 11 78371030 missense probably benign 0.29
R1167:Foxn1 UTSW 11 78359066 missense probably damaging 0.99
R1251:Foxn1 UTSW 11 78358785 missense probably damaging 0.99
R1474:Foxn1 UTSW 11 78361107 missense probably benign
R1506:Foxn1 UTSW 11 78365935 splice site probably benign
R1616:Foxn1 UTSW 11 78358866 missense probably benign 0.00
R1795:Foxn1 UTSW 11 78371225 missense probably benign 0.01
R1906:Foxn1 UTSW 11 78371810 splice site probably null
R1975:Foxn1 UTSW 11 78365937 splice site probably benign
R1976:Foxn1 UTSW 11 78365937 splice site probably benign
R2206:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2207:Foxn1 UTSW 11 78358804 missense probably benign 0.02
R2988:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R2989:Foxn1 UTSW 11 78358777 missense possibly damaging 0.74
R5015:Foxn1 UTSW 11 78371163 missense probably damaging 1.00
R5140:Foxn1 UTSW 11 78361633 missense probably benign 0.18
R5533:Foxn1 UTSW 11 78365966 missense probably damaging 1.00
R6712:Foxn1 UTSW 11 78361259 missense probably damaging 1.00
R6852:Foxn1 UTSW 11 78360960 missense probably benign 0.00
X0067:Foxn1 UTSW 11 78361542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGGCTGATGGGTTCCATATC -3'
(R):5'- ATGCCTAGACGTTGGTCCTC -3'

Sequencing Primer
(F):5'- GTTCCATATCTGGGGAAACACC -3'
(R):5'- GACGTTGGTCCTCATTCTCATTGTAG -3'
Posted On2014-07-14