Incidental Mutation 'R1905:Ncoa1'
ID214313
Institutional Source Beutler Lab
Gene Symbol Ncoa1
Ensembl Gene ENSMUSG00000020647
Gene Namenuclear receptor coactivator 1
SynonymsbHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1
MMRRC Submission 039924-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1905 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4247362-4477182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4295433 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 638 (V638A)
Ref Sequence ENSEMBL: ENSMUSP00000151358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217674] [ENSMUST00000217794] [ENSMUST00000219275] [ENSMUST00000220434]
Predicted Effect probably damaging
Transcript: ENSMUST00000085814
AA Change: V638A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: V638A

DomainStartEndE-ValueType
HLH 29 86 1.73e-9 SMART
PAS 111 178 1.32e-10 SMART
Pfam:PAS_11 259 370 8e-37 PFAM
low complexity region 419 441 N/A INTRINSIC
Pfam:NCOA_u2 468 591 1.3e-29 PFAM
Pfam:SRC-1 632 712 3.5e-26 PFAM
low complexity region 724 736 N/A INTRINSIC
PDB:3RVF|B 747 767 1e-6 PDB
low complexity region 777 785 N/A INTRINSIC
low complexity region 869 880 N/A INTRINSIC
Pfam:Nuc_rec_co-act 930 977 2.3e-23 PFAM
low complexity region 1059 1080 N/A INTRINSIC
low complexity region 1125 1137 N/A INTRINSIC
DUF1518 1155 1211 7.47e-16 SMART
DUF1518 1218 1274 1.14e-11 SMART
low complexity region 1303 1315 N/A INTRINSIC
low complexity region 1333 1354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217674
AA Change: V527A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000217794
AA Change: V638A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000219275
Predicted Effect probably damaging
Transcript: ENSMUST00000220434
AA Change: V638A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.356 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,469,680 V153L possibly damaging Het
Adamts17 T A 7: 67,047,472 C631* probably null Het
Adamts19 A G 18: 59,032,945 R1070G possibly damaging Het
Aldh1a1 A G 19: 20,617,998 E97G probably damaging Het
Bola2 T A 7: 126,696,238 V40E probably damaging Het
Ccar1 A G 10: 62,776,658 S243P possibly damaging Het
Cd80 A T 16: 38,474,177 I141F probably damaging Het
Chn2 T C 6: 54,286,121 C92R probably damaging Het
Clk1 A T 1: 58,421,942 probably benign Het
Clock T C 5: 76,266,888 probably benign Het
Cntnap3 A G 13: 64,903,764 V26A probably benign Het
Csf3r A T 4: 126,042,745 K651N probably benign Het
Cul4a T C 8: 13,133,171 M322T probably benign Het
Cx3cl1 A G 8: 94,780,059 T231A probably benign Het
Cyp2c68 A T 19: 39,735,582 C213S probably benign Het
Dhx16 T G 17: 35,888,355 S814A probably benign Het
Dnah1 T C 14: 31,264,630 I3659V probably benign Het
Dock6 A T 9: 21,829,574 V906D probably benign Het
Ep400 G A 5: 110,670,948 T2738I probably damaging Het
Erbb4 A T 1: 68,075,410 probably benign Het
Fam135b C T 15: 71,532,987 R70H probably damaging Het
Fam13a T C 6: 58,953,490 Q479R probably damaging Het
Fam96a A G 9: 66,132,647 K82R probably benign Het
Fcgr4 A T 1: 171,029,305 Q247L probably damaging Het
Flnc T A 6: 29,459,460 C2520S probably damaging Het
Foxn1 A G 11: 78,371,810 probably null Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 T295I probably damaging Het
Gm10499 T C 17: 36,142,941 noncoding transcript Het
Gm340 A G 19: 41,583,574 D256G possibly damaging Het
Gm4744 G A 6: 40,951,802 probably benign Het
Gm4871 G T 5: 145,030,049 A208D probably damaging Het
Gm5155 T A 7: 17,873,552 noncoding transcript Het
Gm527 A G 12: 64,921,023 N73S possibly damaging Het
Gm5414 T C 15: 101,624,640 I451V probably damaging Het
Golm1 A T 13: 59,642,251 V245E probably benign Het
Grik1 A T 16: 87,896,866 Y879* probably null Het
Grn C A 11: 102,436,450 P241Q probably damaging Het
Hjurp T C 1: 88,266,616 E190G probably benign Het
Hmcn1 A C 1: 150,992,855 I66S probably damaging Het
Hykk T A 9: 54,946,383 Y330N probably benign Het
Khdc1c A G 1: 21,369,057 N89S probably benign Het
Lrrc72 T A 12: 36,208,662 probably null Het
Lyst T G 13: 13,634,134 S130A probably benign Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mfng T C 15: 78,773,086 T63A probably damaging Het
Mre11a G A 9: 14,799,627 D206N probably benign Het
Myh10 A G 11: 68,771,868 probably benign Het
Myt1 A G 2: 181,797,756 D357G probably damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Nlrp3 T G 11: 59,549,036 F480V probably damaging Het
Nos1ap A G 1: 170,318,558 W476R possibly damaging Het
Nr1h4 T A 10: 89,480,559 T220S possibly damaging Het
Ntf5 G T 7: 45,415,752 V103L probably damaging Het
Ntm C A 9: 29,179,097 D109Y probably damaging Het
Olfr18 C T 9: 20,314,846 E17K probably benign Het
P2rx7 G A 5: 122,680,952 C479Y probably damaging Het
Pappa2 T A 1: 158,803,503 probably null Het
Pgap1 A C 1: 54,511,961 I520R probably benign Het
Pikfyve G A 1: 65,192,295 probably null Het
Plekhg3 T C 12: 76,576,217 S744P probably benign Het
Pramel6 A G 2: 87,509,182 R97G probably damaging Het
Pramel6 G T 2: 87,509,183 R97M probably damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptk2b T C 14: 66,158,670 D783G probably damaging Het
Ptma-ps1 T A 7: 24,063,881 L17* probably null Het
Ralgapa2 C A 2: 146,387,701 R1053L probably damaging Het
Sap130 C T 18: 31,680,567 P559L possibly damaging Het
Sap30 T C 8: 57,487,311 S86G probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3f G T 9: 107,684,376 Q500K probably damaging Het
Serpinb3d T C 1: 107,079,284 I231M possibly damaging Het
Sf3a1 T A 11: 4,176,678 N563K probably benign Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc6a12 G T 6: 121,347,443 E9* probably null Het
Srebf1 T C 11: 60,204,493 D400G probably damaging Het
Swsap1 T C 9: 21,956,692 Y87H probably damaging Het
Tanc2 G A 11: 105,922,863 G1711D possibly damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tdrd9 T A 12: 112,063,627 probably benign Het
Tdrp T C 8: 13,954,079 D86G probably damaging Het
Tmem92 A T 11: 94,778,675 M106K probably benign Het
Tmf1 A T 6: 97,161,479 C764S possibly damaging Het
Ttc21a G T 9: 119,966,757 R1219L possibly damaging Het
Ttn C T 2: 76,763,448 G18870D probably damaging Het
Tubgcp6 T C 15: 89,100,608 Y1732C probably damaging Het
Vmn1r28 A G 6: 58,265,927 T252A probably benign Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Other mutations in Ncoa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ncoa1 APN 12 4278218 missense probably benign
IGL01335:Ncoa1 APN 12 4297520 missense probably benign 0.31
IGL02111:Ncoa1 APN 12 4274944 start codon destroyed probably null
IGL02863:Ncoa1 APN 12 4297513 missense probably benign 0.00
IGL02967:Ncoa1 APN 12 4295294 missense probably damaging 1.00
IGL03007:Ncoa1 APN 12 4339114 missense possibly damaging 0.92
IGL03031:Ncoa1 APN 12 4274818 missense possibly damaging 0.76
IGL03048:Ncoa1 UTSW 12 4267922 missense probably damaging 0.96
IGL03147:Ncoa1 UTSW 12 4259342 missense probably damaging 1.00
PIT1430001:Ncoa1 UTSW 12 4323005 missense probably benign 0.19
PIT4402001:Ncoa1 UTSW 12 4294987 missense probably benign 0.00
R0002:Ncoa1 UTSW 12 4290885 missense probably benign 0.00
R0011:Ncoa1 UTSW 12 4322896 missense possibly damaging 0.94
R0389:Ncoa1 UTSW 12 4295976 missense probably benign 0.05
R0467:Ncoa1 UTSW 12 4267687 missense possibly damaging 0.49
R0480:Ncoa1 UTSW 12 4339105 missense probably damaging 1.00
R0541:Ncoa1 UTSW 12 4323033 missense probably damaging 1.00
R0671:Ncoa1 UTSW 12 4249758 splice site probably null
R1387:Ncoa1 UTSW 12 4274790 missense probably benign 0.01
R1426:Ncoa1 UTSW 12 4270737 splice site probably benign
R1538:Ncoa1 UTSW 12 4270748 missense possibly damaging 0.94
R1577:Ncoa1 UTSW 12 4295196 missense probably damaging 0.99
R1902:Ncoa1 UTSW 12 4339049 missense possibly damaging 0.78
R2026:Ncoa1 UTSW 12 4267647 missense probably benign 0.19
R2259:Ncoa1 UTSW 12 4315819 missense probably damaging 1.00
R2317:Ncoa1 UTSW 12 4275189 missense probably damaging 0.99
R3608:Ncoa1 UTSW 12 4278186 missense probably benign 0.00
R4042:Ncoa1 UTSW 12 4267871 missense probably damaging 0.99
R4688:Ncoa1 UTSW 12 4315781 missense probably benign 0.26
R4763:Ncoa1 UTSW 12 4275297 missense probably damaging 1.00
R4878:Ncoa1 UTSW 12 4275004 missense probably damaging 1.00
R5062:Ncoa1 UTSW 12 4259333 missense probably damaging 0.99
R5531:Ncoa1 UTSW 12 4253746 missense probably benign
R6393:Ncoa1 UTSW 12 4278181 missense probably benign 0.00
R6711:Ncoa1 UTSW 12 4322904 missense probably benign 0.26
R7066:Ncoa1 UTSW 12 4322934 missense possibly damaging 0.90
R7109:Ncoa1 UTSW 12 4322978 missense possibly damaging 0.63
R7170:Ncoa1 UTSW 12 4249722 missense probably benign 0.32
R7395:Ncoa1 UTSW 12 4295188 missense not run
R7453:Ncoa1 UTSW 12 4259307 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAATTTTATGCCGCTC -3'
(R):5'- TTCGGCAGATGAGCTCACAG -3'

Sequencing Primer
(F):5'- GCAGAATTTTATGCCGCTCAGTCAG -3'
(R):5'- TCGGCAGATGAGCTCACAGAATTC -3'
Posted On2014-07-14