Incidental Mutation 'R1906:Sptbn4'
ID214373
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Namespectrin beta, non-erythrocytic 4
SynonymsROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4
MMRRC Submission 039925-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.646) question?
Stock #R1906 (G1)
Quality Score150
Status Not validated
Chromosome7
Chromosomal Location27356383-27447686 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 27391431 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000011895] [ENSMUST00000108362] [ENSMUST00000108362] [ENSMUST00000108363] [ENSMUST00000108363] [ENSMUST00000108364] [ENSMUST00000108364] [ENSMUST00000172269] [ENSMUST00000172269]
Predicted Effect probably null
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000011895
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108362
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108362
SMART Domains Protein: ENSMUSP00000103999
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108363
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108363
SMART Domains Protein: ENSMUSP00000104000
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108364
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108364
SMART Domains Protein: ENSMUSP00000104001
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
SPEC 1 83 9.7e-3 SMART
SPEC 89 188 5.92e-7 SMART
SPEC 194 294 2.45e-22 SMART
SPEC 300 400 1.45e-24 SMART
SPEC 406 507 1.86e-22 SMART
SPEC 513 615 9.54e-11 SMART
SPEC 621 721 1.35e-19 SMART
SPEC 727 977 1.06e-8 SMART
low complexity region 1038 1092 N/A INTRINSIC
PH 1096 1206 1.54e-14 SMART
low complexity region 1229 1240 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172269
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass G A 6: 23,072,985 T923I probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Adamts5 C T 16: 85,868,685 W576* probably null Het
Adnp A T 2: 168,182,367 S1003T probably benign Het
AI987944 C T 7: 41,375,126 R146Q probably benign Het
Apol6 G T 15: 77,050,860 V110F probably damaging Het
Arhgap27 A G 11: 103,332,925 F651L probably damaging Het
Atm T C 9: 53,506,568 D813G probably damaging Het
Casd1 T A 6: 4,641,979 I752N probably damaging Het
Cdr2 A G 7: 120,982,001 Y18H probably damaging Het
Cntn4 T C 6: 106,353,646 F75S probably benign Het
Col20a1 G A 2: 180,998,697 R549H probably benign Het
Col28a1 A T 6: 7,999,644 N1024K probably benign Het
Ddx58 T C 4: 40,206,054 K846R probably benign Het
Dnah10 T A 5: 124,800,984 V2654D probably damaging Het
Dnph1 A T 17: 46,496,861 I18F probably damaging Het
Dsn1 G A 2: 156,996,243 R334W probably damaging Het
Egf T A 3: 129,725,224 K325N probably benign Het
Eps15 T G 4: 109,324,201 S311A possibly damaging Het
Fmo3 G T 1: 162,966,906 D198E probably damaging Het
Folh1 C G 7: 86,742,166 probably null Het
Foxn1 A G 11: 78,371,810 probably null Het
Gm10604 T G 4: 11,979,989 D105A unknown Het
Gpx8 A G 13: 113,045,576 C108R probably damaging Het
Herc2 A T 7: 56,114,864 I1013L probably benign Het
Hyal4 T G 6: 24,756,111 N109K probably damaging Het
Il22ra1 T G 4: 135,751,233 C538W probably damaging Het
Ints13 A T 6: 146,552,370 probably null Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lama2 A C 10: 27,056,527 probably null Het
Lifr G T 15: 7,188,131 V847L probably damaging Het
Lmf1 T A 17: 25,612,335 I185N probably damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Ms4a15 T C 19: 10,983,280 I94V probably benign Het
Mycbpap A T 11: 94,505,621 M131K probably benign Het
Ncor1 A T 11: 62,349,385 M920K possibly damaging Het
Neb A G 2: 52,308,526 Y437H probably damaging Het
Npy5r A T 8: 66,681,473 W223R probably damaging Het
Olfr1219 A G 2: 89,075,070 V7A possibly damaging Het
Olfr1333 G A 4: 118,830,270 H56Y probably damaging Het
Olfr248 C A 1: 174,391,164 L32M probably damaging Het
Olfr804 T G 10: 129,705,496 V206G probably benign Het
Polg T C 7: 79,460,322 K353E probably damaging Het
Proz C G 8: 13,073,686 probably null Het
Pus7 T C 5: 23,778,211 D86G probably damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Srp68 A T 11: 116,250,761 I424N probably damaging Het
Stard9 A G 2: 120,696,427 E1055G probably benign Het
Taf4b A G 18: 14,822,102 I571V probably benign Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Thap12 T C 7: 98,716,740 L705P probably damaging Het
Tom1 T C 8: 75,051,590 V100A probably damaging Het
Tox3 A G 8: 90,248,429 probably benign Het
Vmn2r82 A G 10: 79,396,510 N781S probably damaging Het
Vwa5b1 A T 4: 138,600,236 V343E possibly damaging Het
Zbbx A G 3: 75,071,740 Y467H probably damaging Het
Zbtb46 G A 2: 181,423,839 R173W probably damaging Het
Zfp112 A G 7: 24,122,295 D20G probably benign Het
Zfp777 A C 6: 48,042,061 M313R probably damaging Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27369434 missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27417965 missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27414771 missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27404268 missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27364146 missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27364515 missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27364357 missense probably benign
IGL02226:Sptbn4 APN 7 27365707 missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27364299 missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27428247 missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27365589 missense probably null 0.15
IGL02487:Sptbn4 APN 7 27419097 missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27391551 missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27367679 missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27426833 missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27394148 splice site probably benign
IGL02961:Sptbn4 APN 7 27397967 missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27357387 nonsense probably null
R0194:Sptbn4 UTSW 7 27404911 missense probably benign 0.00
R0328:Sptbn4 UTSW 7 27364170 missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27359736 splice site probably benign
R0510:Sptbn4 UTSW 7 27361566 critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27364378 missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27408328 nonsense probably null
R1336:Sptbn4 UTSW 7 27417963 missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27434294 missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27418739 missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27418583 missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27366646 missense probably null 0.96
R1924:Sptbn4 UTSW 7 27407138 missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27366443 missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27423810 missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27366419 nonsense probably null
R2083:Sptbn4 UTSW 7 27428256 missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27364162 missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27367609 missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27434357 missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27360092 missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27418098 nonsense probably null
R4115:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27391570 missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27418471 missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27423798 missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27367702 missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27364419 missense probably damaging 0.96
R4684:Sptbn4 UTSW 7 27366735 missense possibly damaging 0.60
R4707:Sptbn4 UTSW 7 27417006 missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27372152 missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27369391 missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27359741 critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27366428 missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27418713 missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27404253 missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27372171 missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27418599 missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27364479 missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27364170 missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27360088 missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27364587 nonsense probably null
R6762:Sptbn4 UTSW 7 27394208 missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27371950 missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27418056 missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27416785 missense probably benign 0.44
X0020:Sptbn4 UTSW 7 27402734 critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27357311 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTTCTCTTACCTCTGGGC -3'
(R):5'- AATTAGGTGAGATCCGGCAGTG -3'

Sequencing Primer
(F):5'- CACACAGAAAATATTGAATCCTGAGG -3'
(R):5'- CTAGTGCAGAGCTTCGC -3'
Posted On2014-07-14