Incidental Mutation 'R1907:Reln'
ID214447
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Namereelin
Synonyms
MMRRC Submission 039926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1907 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21884454-22344702 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 22044962 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
Predicted Effect probably null
Transcript: ENSMUST00000062372
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159741
Predicted Effect probably null
Transcript: ENSMUST00000161356
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162427
Meta Mutation Damage Score 0.592 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptbp2 A T 3: 119,761,749 S23R probably damaging Het
Ptpn13 A G 5: 103,580,709 D2074G probably null Het
Rab34 T A 11: 78,191,255 L166H probably damaging Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00091:Reln APN 5 22039565 missense possibly damaging 0.57
IGL00432:Reln APN 5 22010127 missense probably damaging 1.00
IGL00433:Reln APN 5 22045009 missense probably damaging 1.00
IGL00576:Reln APN 5 22154950 missense probably benign 0.01
IGL00755:Reln APN 5 22060380 missense probably damaging 0.98
IGL00777:Reln APN 5 22018850 critical splice donor site probably null
IGL00900:Reln APN 5 21980117 missense probably damaging 0.98
IGL01067:Reln APN 5 21979666 missense probably damaging 1.00
IGL01104:Reln APN 5 21986967 missense probably damaging 0.99
IGL01141:Reln APN 5 21969033 missense probably damaging 1.00
IGL01141:Reln APN 5 21919069 missense probably damaging 1.00
IGL01333:Reln APN 5 22171251 missense probably damaging 0.99
IGL01341:Reln APN 5 21969079 missense probably damaging 1.00
IGL01354:Reln APN 5 21919175 nonsense probably null
IGL01361:Reln APN 5 21919021 missense probably benign 0.06
IGL01446:Reln APN 5 21969317 missense probably damaging 0.99
IGL01448:Reln APN 5 22040405 missense probably benign 0.40
IGL01612:Reln APN 5 21896930 missense probably damaging 0.99
IGL01695:Reln APN 5 21920438 missense probably damaging 1.00
IGL01718:Reln APN 5 21947514 missense possibly damaging 0.60
IGL01749:Reln APN 5 22344246 nonsense probably null
IGL01875:Reln APN 5 21904717 missense probably benign
IGL02013:Reln APN 5 21950879 missense probably damaging 1.00
IGL02031:Reln APN 5 21979016 missense probably damaging 0.99
IGL02186:Reln APN 5 21909958 missense probably damaging 1.00
IGL02228:Reln APN 5 21904731 missense probably damaging 0.99
IGL02248:Reln APN 5 21910992 missense probably damaging 1.00
IGL02336:Reln APN 5 21929134 missense probably damaging 1.00
IGL02352:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02359:Reln APN 5 22039565 missense possibly damaging 0.57
IGL02376:Reln APN 5 22080791 nonsense probably null
IGL02408:Reln APN 5 21901619 missense probably benign 0.44
IGL02415:Reln APN 5 21971951 missense possibly damaging 0.91
IGL02512:Reln APN 5 22040427 missense probably benign 0.00
IGL02540:Reln APN 5 22034752 missense probably damaging 0.96
IGL02624:Reln APN 5 22103357 missense probably benign 0.09
IGL02720:Reln APN 5 21997941 missense probably damaging 0.99
IGL02894:Reln APN 5 21885548 missense possibly damaging 0.72
IGL02999:Reln APN 5 21995365 missense probably damaging 1.00
IGL03125:Reln APN 5 21910844 missense probably damaging 1.00
IGL03298:Reln APN 5 21910836 missense probably damaging 0.99
fishing UTSW 5 21896841 missense probably damaging 1.00
P0020:Reln UTSW 5 22106060 missense possibly damaging 0.91
R0018:Reln UTSW 5 21925371 missense probably benign 0.01
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0105:Reln UTSW 5 22048815 missense probably damaging 0.99
R0127:Reln UTSW 5 22004136 missense probably damaging 1.00
R0135:Reln UTSW 5 22128649 missense probably damaging 0.99
R0144:Reln UTSW 5 21948449 missense probably damaging 0.97
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0240:Reln UTSW 5 22106045 missense probably benign 0.36
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0242:Reln UTSW 5 21942597 critical splice donor site probably null
R0266:Reln UTSW 5 21988776 missense probably damaging 1.00
R0269:Reln UTSW 5 21920537 missense probably damaging 1.00
R0280:Reln UTSW 5 22227513 splice site probably benign
R0333:Reln UTSW 5 21929242 missense probably damaging 0.97
R0357:Reln UTSW 5 21950822 missense probably damaging 1.00
R0359:Reln UTSW 5 22048800 missense probably damaging 0.98
R0506:Reln UTSW 5 21920496 missense probably damaging 0.97
R0534:Reln UTSW 5 21947408 missense probably damaging 0.99
R0535:Reln UTSW 5 22051276 splice site probably benign
R0541:Reln UTSW 5 21980109 missense possibly damaging 0.88
R0615:Reln UTSW 5 22010150 missense probably benign 0.36
R0617:Reln UTSW 5 21920537 missense probably damaging 1.00
R0634:Reln UTSW 5 22018869 missense probably damaging 1.00
R0653:Reln UTSW 5 21913230 missense probably benign 0.44
R0704:Reln UTSW 5 21896811 missense probably damaging 0.99
R0706:Reln UTSW 5 21896811 missense probably damaging 0.99
R0959:Reln UTSW 5 22227628 missense probably damaging 0.96
R1066:Reln UTSW 5 22034664 missense probably damaging 1.00
R1110:Reln UTSW 5 22034775 missense probably benign
R1163:Reln UTSW 5 21899029 missense probably benign 0.03
R1222:Reln UTSW 5 21986955 missense probably null 0.97
R1226:Reln UTSW 5 21910866 missense probably damaging 1.00
R1440:Reln UTSW 5 22128602 splice site probably benign
R1532:Reln UTSW 5 22034744 missense probably damaging 0.99
R1552:Reln UTSW 5 21960378 missense probably benign 0.01
R1565:Reln UTSW 5 21925213 missense probably benign 0.05
R1618:Reln UTSW 5 22060368 missense probably benign 0.01
R1636:Reln UTSW 5 21998683 missense probably damaging 0.99
R1664:Reln UTSW 5 21929086 missense probably damaging 1.00
R1716:Reln UTSW 5 21955095 missense probably damaging 0.98
R1759:Reln UTSW 5 22010289 missense probably damaging 0.99
R1835:Reln UTSW 5 21979002 missense probably damaging 1.00
R1991:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2046:Reln UTSW 5 21942627 missense probably benign 0.01
R2072:Reln UTSW 5 21919177 missense probably damaging 1.00
R2103:Reln UTSW 5 21969360 missense possibly damaging 0.56
R2119:Reln UTSW 5 22019000 missense probably damaging 1.00
R2120:Reln UTSW 5 21969085 missense probably damaging 1.00
R2216:Reln UTSW 5 22048005 missense probably benign 0.30
R2219:Reln UTSW 5 21972047 missense possibly damaging 0.88
R2228:Reln UTSW 5 21987078 missense possibly damaging 0.69
R2306:Reln UTSW 5 21896786 missense probably damaging 1.00
R2316:Reln UTSW 5 22154956 missense probably benign 0.00
R2321:Reln UTSW 5 21915020 missense probably damaging 0.99
R2512:Reln UTSW 5 21979690 missense possibly damaging 0.89
R2519:Reln UTSW 5 22344369 missense unknown
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2870:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2871:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R2872:Reln UTSW 5 22049791 missense possibly damaging 0.95
R3195:Reln UTSW 5 22040420 missense possibly damaging 0.72
R3545:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3546:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3547:Reln UTSW 5 22227600 missense possibly damaging 0.64
R3706:Reln UTSW 5 21995589 splice site probably benign
R3713:Reln UTSW 5 21904734 missense probably damaging 0.99
R3770:Reln UTSW 5 21948566 missense probably damaging 1.00
R3836:Reln UTSW 5 21911014 missense probably damaging 1.00
R3887:Reln UTSW 5 21910849 missense possibly damaging 0.92
R3972:Reln UTSW 5 21979001 missense probably damaging 0.99
R3975:Reln UTSW 5 21995366 missense possibly damaging 0.57
R4022:Reln UTSW 5 22227630 missense probably benign 0.45
R4044:Reln UTSW 5 22128632 missense possibly damaging 0.82
R4107:Reln UTSW 5 22034584 missense probably damaging 1.00
R4297:Reln UTSW 5 21920487 missense probably damaging 0.99
R4298:Reln UTSW 5 21920487 missense probably damaging 0.99
R4299:Reln UTSW 5 21920487 missense probably damaging 0.99
R4518:Reln UTSW 5 21901743 missense probably benign 0.44
R4615:Reln UTSW 5 21972872 missense possibly damaging 0.95
R4713:Reln UTSW 5 22152463 missense probably benign 0.17
R4720:Reln UTSW 5 22286896 missense possibly damaging 0.71
R4721:Reln UTSW 5 21919222 missense probably damaging 0.99
R4771:Reln UTSW 5 22049700 missense probably damaging 1.00
R4794:Reln UTSW 5 22344185 missense probably damaging 0.98
R4840:Reln UTSW 5 22018846 splice site probably null
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4860:Reln UTSW 5 21901751 missense probably benign 0.06
R4896:Reln UTSW 5 21955238 missense probably damaging 1.00
R4908:Reln UTSW 5 21979720 missense probably benign 0.02
R4912:Reln UTSW 5 21925193 missense probably benign 0.29
R4922:Reln UTSW 5 21995587 critical splice acceptor site probably null
R4975:Reln UTSW 5 21960426 missense probably damaging 1.00
R4976:Reln UTSW 5 21971870 missense probably benign 0.05
R5020:Reln UTSW 5 22034638 missense probably damaging 1.00
R5037:Reln UTSW 5 21948512 missense probably damaging 1.00
R5082:Reln UTSW 5 21896077 missense probably benign 0.00
R5119:Reln UTSW 5 21971870 missense probably benign 0.05
R5125:Reln UTSW 5 21913241 missense possibly damaging 0.78
R5137:Reln UTSW 5 21955181 missense probably damaging 1.00
R5152:Reln UTSW 5 21948629 missense probably damaging 1.00
R5154:Reln UTSW 5 21988765 missense probably damaging 0.99
R5259:Reln UTSW 5 22103397 missense possibly damaging 0.83
R5283:Reln UTSW 5 22011163 missense probably damaging 1.00
R5386:Reln UTSW 5 22039529 missense probably benign
R5400:Reln UTSW 5 21979714 missense probably damaging 1.00
R5478:Reln UTSW 5 22004203 missense probably benign 0.00
R5514:Reln UTSW 5 21971885 missense possibly damaging 0.93
R5529:Reln UTSW 5 21932715 missense possibly damaging 0.71
R5611:Reln UTSW 5 22039665 nonsense probably null
R5648:Reln UTSW 5 21998572 missense probably benign 0.04
R5649:Reln UTSW 5 21901625 missense probably benign 0.33
R5744:Reln UTSW 5 22106083 missense probably null 0.39
R5782:Reln UTSW 5 22018056 missense probably benign 0.01
R5815:Reln UTSW 5 21947433 missense probably damaging 0.99
R5838:Reln UTSW 5 21899113 missense probably damaging 0.97
R6162:Reln UTSW 5 21911050 missense probably damaging 1.00
R6219:Reln UTSW 5 21948596 missense probably damaging 1.00
R6259:Reln UTSW 5 22060333 missense probably damaging 0.99
R6279:Reln UTSW 5 21896841 missense probably damaging 1.00
R6299:Reln UTSW 5 22286944 missense possibly damaging 0.71
R6300:Reln UTSW 5 21896841 missense probably damaging 1.00
R6314:Reln UTSW 5 22152484 nonsense probably null
R6351:Reln UTSW 5 21901663 nonsense probably null
R6369:Reln UTSW 5 22051361 missense probably benign 0.03
R6371:Reln UTSW 5 21995513 missense probably benign
R6374:Reln UTSW 5 22080714 missense probably benign 0.06
R6425:Reln UTSW 5 21911020 nonsense probably null
R6442:Reln UTSW 5 21932776 missense probably benign
R6445:Reln UTSW 5 21919214 missense probably benign 0.05
R6554:Reln UTSW 5 21896840 missense probably damaging 1.00
R6641:Reln UTSW 5 21929134 missense probably damaging 1.00
R6768:Reln UTSW 5 21978907 missense probably damaging 0.99
R6859:Reln UTSW 5 22034570 missense probably damaging 1.00
R6896:Reln UTSW 5 21899179 missense probably benign 0.18
R6932:Reln UTSW 5 21985857 missense probably benign 0.00
R6948:Reln UTSW 5 21972035 missense probably damaging 1.00
R6959:Reln UTSW 5 21976564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTGATCAACACATTATGCATAC -3'
(R):5'- ATCCAAGTGCCCCATGCTTC -3'

Sequencing Primer
(F):5'- TGCATACACATTACATAATACACCTC -3'
(R):5'- GGCTTTCCAATTACGTTGC -3'
Posted On2014-07-14