Incidental Mutation 'R0127:Mkrn1'
ID21445
Institutional Source Beutler Lab
Gene Symbol Mkrn1
Ensembl Gene ENSMUSG00000029922
Gene Namemakorin, ring finger protein, 1
Synonyms
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0127 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location39397804-39420462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39399275 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 466 (W466R)
Ref Sequence ENSEMBL: ENSMUSP00000031985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031985] [ENSMUST00000051671] [ENSMUST00000114823]
Predicted Effect probably benign
Transcript: ENSMUST00000031985
AA Change: W466R

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031985
Gene: ENSMUSG00000029922
AA Change: W466R

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 334 2.09e-7 SMART
low complexity region 349 363 N/A INTRINSIC
ZnF_C3H1 366 392 2.53e-2 SMART
Pfam:MKRN1_C 400 479 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051671
SMART Domains Protein: ENSMUSP00000084244
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 328 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114823
AA Change: W402R

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000110471
Gene: ENSMUSG00000029922
AA Change: W402R

DomainStartEndE-ValueType
ZnF_C3H1 1 17 6.26e1 SMART
ZnF_C3H1 21 46 8.27e-7 SMART
low complexity region 58 78 N/A INTRINSIC
ZnF_C3H1 144 170 1.13e-4 SMART
RING 217 270 2.09e-7 SMART
low complexity region 285 299 N/A INTRINSIC
ZnF_C3H1 302 328 2.53e-2 SMART
low complexity region 378 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122874
Predicted Effect probably benign
Transcript: ENSMUST00000122996
SMART Domains Protein: ENSMUSP00000115231
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 75 96 4.11e-2 SMART
ZnF_C3H1 100 125 8.27e-7 SMART
low complexity region 137 157 N/A INTRINSIC
ZnF_C3H1 223 249 1.13e-4 SMART
RING 296 343 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150575
SMART Domains Protein: ENSMUSP00000121563
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
RING 52 105 2.09e-7 SMART
low complexity region 170 191 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and fertile, and show normal kidney morphology, eyelid development, and skeletal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dlx4 T G 11: 95,141,229 M240L probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc12a1 A G 2: 125,219,762 R958G probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spag4 T C 2: 156,068,042 V302A probably damaging Het
Spire2 A C 8: 123,358,097 probably benign Het
Sptbn2 G T 19: 4,724,744 V142L probably damaging Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Trim12c A G 7: 104,340,906 probably null Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Mkrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Mkrn1 APN 6 39405913 missense possibly damaging 0.80
IGL03235:Mkrn1 APN 6 39401330 missense probably damaging 1.00
R0445:Mkrn1 UTSW 6 39404854 missense probably benign 0.28
R1109:Mkrn1 UTSW 6 39399334 missense probably damaging 1.00
R1366:Mkrn1 UTSW 6 39405917 missense probably benign 0.02
R1783:Mkrn1 UTSW 6 39400456 missense probably null
R2002:Mkrn1 UTSW 6 39405803 missense probably benign 0.00
R4671:Mkrn1 UTSW 6 39405757 missense probably damaging 1.00
R4889:Mkrn1 UTSW 6 39420005 unclassified probably benign
Z1088:Mkrn1 UTSW 6 39400456 missense probably null
Predicted Primers PCR Primer
(F):5'- GATCACAGCACCTGGAGTTTGAGAG -3'
(R):5'- TGCCACACGGTTTACCTGATGAG -3'

Sequencing Primer
(F):5'- CCACGCAACGCTGCTATA -3'
(R):5'- AGACACTGCTTGACAGTGC -3'
Posted On2013-04-11