Incidental Mutation 'R1907:Rab34'
ID214496
Institutional Source Beutler Lab
Gene Symbol Rab34
Ensembl Gene ENSMUSG00000002059
Gene NameRAB34, member RAS oncogene family
SynonymsRah1, Narr
MMRRC Submission 039926-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R1907 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78188430-78192193 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78191255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 166 (L166H)
Ref Sequence ENSEMBL: ENSMUSP00000123033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002128] [ENSMUST00000056241] [ENSMUST00000060539] [ENSMUST00000078099] [ENSMUST00000108317] [ENSMUST00000108322] [ENSMUST00000150941] [ENSMUST00000207728]
Predicted Effect probably damaging
Transcript: ENSMUST00000002128
AA Change: L160H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002128
Gene: ENSMUSG00000002059
AA Change: L160H

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056241
AA Change: L160H

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059769
Gene: ENSMUSG00000002059
AA Change: L160H

DomainStartEndE-ValueType
Pfam:Arf 43 205 9.5e-13 PFAM
Pfam:Miro 54 166 9.3e-17 PFAM
Pfam:MMR_HSR1 54 204 4.4e-7 PFAM
Pfam:Ras 54 210 4.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060539
SMART Domains Protein: ENSMUSP00000050319
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078099
SMART Domains Protein: ENSMUSP00000086022
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
coiled coil region 92 121 N/A INTRINSIC
low complexity region 148 161 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108317
SMART Domains Protein: ENSMUSP00000103953
Gene: ENSMUSG00000044122

DomainStartEndE-ValueType
Blast:PA2c 33 99 2e-12 BLAST
SCOP:d1poc__ 55 102 5e-4 SMART
coiled coil region 179 208 N/A INTRINSIC
low complexity region 235 248 N/A INTRINSIC
low complexity region 285 299 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108322
AA Change: L160H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103958
Gene: ENSMUSG00000002059
AA Change: L160H

DomainStartEndE-ValueType
RAB 54 219 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148603
Predicted Effect probably damaging
Transcript: ENSMUST00000150941
AA Change: L166H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123033
Gene: ENSMUSG00000002059
AA Change: L166H

DomainStartEndE-ValueType
RAB 60 225 2.96e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154542
Predicted Effect unknown
Transcript: ENSMUST00000156435
AA Change: L111H
SMART Domains Protein: ENSMUSP00000122848
Gene: ENSMUSG00000002059
AA Change: L111H

DomainStartEndE-ValueType
Pfam:Arf 1 167 4.1e-17 PFAM
Pfam:Roc 6 122 4.5e-32 PFAM
Pfam:MMR_HSR1 6 156 2.3e-8 PFAM
Pfam:Ras 6 168 1.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207728
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 98% (104/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the RAB family of proteins, which are small GTPases involved in protein transport. This family member is a Golgi-bound member of the secretory pathway that is involved in the repositioning of lysosomes and the activation of macropinocytosis. Alternative splicing of this gene results in multiple transcript variants. An alternatively spliced transcript variant produces the nine-amino acid residue-repeats (NARR) protein, which is a functionally distinct nucleolar protein resulting from a different reading frame. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 C A 3: 122,069,012 S206R probably damaging Het
Abcc6 G T 7: 46,014,169 A357E probably benign Het
Abhd13 T A 8: 9,988,170 C256S probably benign Het
Actrt3 A G 3: 30,598,567 V126A probably damaging Het
Adgrv1 A G 13: 81,592,551 probably benign Het
Alyref2 A G 1: 171,504,270 D205G probably damaging Het
Amigo3 G A 9: 108,053,636 R86Q probably benign Het
Ankrd50 G C 3: 38,454,052 P1389A probably damaging Het
Aoah A G 13: 20,910,094 D183G probably damaging Het
Arap3 A T 18: 37,996,671 S146T probably benign Het
Atp2c2 T C 8: 119,749,876 probably benign Het
Atp8b2 C T 3: 89,946,276 V682M probably benign Het
Cacna1i T C 15: 80,375,264 I1245T probably damaging Het
Card14 A G 11: 119,331,259 N460S probably benign Het
Ceacam5 A G 7: 17,752,384 D602G possibly damaging Het
Cecr2 T A 6: 120,761,160 H921Q probably benign Het
Cyb5d1 T C 11: 69,394,740 D115G probably benign Het
Dbp C T 7: 45,708,320 T67I possibly damaging Het
Dennd5b C T 6: 149,041,576 V601I probably benign Het
Dnah11 G A 12: 118,127,556 A947V possibly damaging Het
Dpysl3 T A 18: 43,438,128 D27V probably damaging Het
Drd1 A T 13: 54,053,252 D307E possibly damaging Het
Dscaml1 G A 9: 45,740,480 G277D probably damaging Het
Eif4g3 C T 4: 138,158,415 R842W probably damaging Het
Enam C T 5: 88,504,622 T1330I possibly damaging Het
Fabp6 T C 11: 43,596,167 probably null Het
Fam160a1 T C 3: 85,672,633 D755G probably benign Het
Fsip2 C T 2: 82,983,428 P3364S possibly damaging Het
Fuk A T 8: 110,893,378 L289* probably null Het
Gad1 C T 2: 70,579,138 S191F possibly damaging Het
Gcm1 A C 9: 78,064,773 N332T probably benign Het
Gin1 G A 1: 97,775,447 probably benign Het
Gpr25 T C 1: 136,260,800 D25G probably benign Het
Gstm4 T C 3: 108,041,277 T172A probably benign Het
Hnrnpll A G 17: 80,035,329 probably null Het
Il12rb2 T A 6: 67,295,286 K339* probably null Het
Inpp1 A G 1: 52,789,670 *397Q probably null Het
Kcp G T 6: 29,497,835 probably benign Het
Kdm1b G A 13: 47,064,120 V352I probably benign Het
Klhdc2 G T 12: 69,296,960 probably benign Het
Krt75 T A 15: 101,573,366 T156S possibly damaging Het
Lag3 T A 6: 124,909,487 I168F possibly damaging Het
Lama4 T G 10: 39,072,758 V839G probably benign Het
Lmtk2 G T 5: 144,175,110 V883L probably benign Het
Lrrc37a C A 11: 103,457,156 K2904N unknown Het
Macf1 A T 4: 123,372,399 I4775N probably damaging Het
Map2k3 T G 11: 60,932,229 S3A possibly damaging Het
Mast1 G A 8: 84,916,266 R967C probably damaging Het
Mettl2 T G 11: 105,126,840 S59A probably benign Het
Mtr G A 13: 12,225,532 T530I probably damaging Het
Myo7b A T 18: 31,976,999 C1137S possibly damaging Het
Nacad T A 11: 6,602,540 H217L probably benign Het
Ncstn A T 1: 172,072,143 V324E probably damaging Het
Ndufaf7 C A 17: 78,942,117 H148N possibly damaging Het
Olfr1048 T C 2: 86,236,110 K242E possibly damaging Het
Olfr517 T A 7: 108,868,498 I219F possibly damaging Het
Olfr628 T A 7: 103,731,983 I19N probably damaging Het
Olfr667 G A 7: 104,917,065 T77I probably damaging Het
Olfr834 T C 9: 18,988,441 I151T possibly damaging Het
Olfr874 T G 9: 37,746,433 L100V probably benign Het
Pcdh20 T C 14: 88,468,704 I387V probably benign Het
Pclo A G 5: 14,678,511 probably benign Het
Pcp2 G A 8: 3,624,904 probably benign Het
Pde1a T A 2: 79,868,307 D393V probably damaging Het
Pias4 T C 10: 81,154,363 D421G possibly damaging Het
Pign T C 1: 105,638,215 T362A possibly damaging Het
Pik3c2g A C 6: 139,844,042 K304Q probably damaging Het
Pkd2 T A 5: 104,486,806 W568R probably damaging Het
Pld2 T A 11: 70,544,184 I306N probably damaging Het
Plppr3 T C 10: 79,874,069 K9R probably damaging Het
Pramef6 T A 4: 143,895,491 R431S possibly damaging Het
Psme4 T C 11: 30,810,922 V397A probably damaging Het
Ptbp2 A T 3: 119,761,749 S23R probably damaging Het
Ptpn13 A G 5: 103,580,709 D2074G probably null Het
Rabgap1l T A 1: 160,645,310 R519S probably benign Het
Rasa1 A T 13: 85,226,572 L218* probably null Het
Reln A G 5: 22,044,962 probably null Het
Rer1 T C 4: 155,078,499 D94G possibly damaging Het
Rhpn1 T C 15: 75,711,824 V386A probably benign Het
Samd3 T A 10: 26,271,856 C476* probably null Het
Sdk2 C T 11: 113,838,646 silent Het
Sipa1l3 A G 7: 29,339,167 S352P possibly damaging Het
Slc27a2 A G 2: 126,586,342 Y549C probably benign Het
Slc7a9 A G 7: 35,449,854 T7A probably benign Het
Slco4c1 C T 1: 96,842,499 G280D probably damaging Het
Snx19 T A 9: 30,433,576 V657E probably damaging Het
Spata31d1c A G 13: 65,035,876 M411V probably benign Het
Spice1 T A 16: 44,357,830 L72* probably null Het
Stard9 G T 2: 120,713,812 V4471L probably damaging Het
Syt14 A G 1: 192,901,835 L707P probably damaging Het
Tab1 T C 15: 80,153,668 I234T probably damaging Het
Tas2r107 T C 6: 131,659,988 M33V probably benign Het
Tbx4 T A 11: 85,914,523 S479R possibly damaging Het
Tssk5 C T 15: 76,372,893 R263Q probably benign Het
Ttn T C 2: 76,870,856 probably benign Het
Ugt2b5 T A 5: 87,139,630 Q226L probably benign Het
Ush2a C T 1: 188,715,064 S2483L probably benign Het
Wdr95 A G 5: 149,552,426 Y63C probably damaging Het
Xirp2 A G 2: 67,516,356 I2980M probably damaging Het
Yeats4 G A 10: 117,215,731 T207I probably benign Het
Ythdc1 A G 5: 86,830,630 R561G probably damaging Het
Zbtb14 G A 17: 69,387,390 E28K possibly damaging Het
Zfp931 A T 2: 178,069,891 L21Q probably damaging Het
Zyg11b A C 4: 108,255,226 M415R probably damaging Het
Other mutations in Rab34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Rab34 APN 11 78191438 missense probably damaging 1.00
IGL03180:Rab34 APN 11 78190318 missense probably damaging 1.00
R0190:Rab34 UTSW 11 78191406 missense possibly damaging 0.95
R0465:Rab34 UTSW 11 78190511 nonsense probably null
R1201:Rab34 UTSW 11 78190396 splice site probably null
R4411:Rab34 UTSW 11 78188766 unclassified probably null
R5564:Rab34 UTSW 11 78191632 missense probably damaging 1.00
R5952:Rab34 UTSW 11 78190268 unclassified probably benign
R6261:Rab34 UTSW 11 78191202 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGGACTTGCCAACAATGC -3'
(R):5'- CCCAGTACTCGGCCTTAATC -3'

Sequencing Primer
(F):5'- CTTGCCAACAATGCATAGAAATCTGG -3'
(R):5'- AATCTCTTGGGCCACCTTGAGG -3'
Posted On2014-07-14