Incidental Mutation 'R0127:Trim12c'
ID21451
Institutional Source Beutler Lab
Gene Symbol Trim12c
Ensembl Gene ENSMUSG00000057143
Gene Nametripartite motif-containing 12C
SynonymsTrim12-2, 9230105E10Rik
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R0127 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location104338754-104353362 bp(-) (GRCm38)
Type of Mutationunclassified (4289 bp from exon)
DNA Base Change (assembly) A to G at 104340906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059037] [ENSMUST00000106847] [ENSMUST00000130139] [ENSMUST00000180136]
Predicted Effect probably damaging
Transcript: ENSMUST00000059037
AA Change: F455L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060100
Gene: ENSMUSG00000057143
AA Change: F455L

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Pfam:SPRY 351 493 8.7e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106847
SMART Domains Protein: ENSMUSP00000102460
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 3e-21 BLAST
Pfam:SPRY 347 474 7.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130139
AA Change: F455L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116775
Gene: ENSMUSG00000057143
AA Change: F455L

DomainStartEndE-ValueType
RING 15 58 5.51e-7 SMART
BBOX 91 132 4.83e-12 SMART
low complexity region 196 209 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180136
SMART Domains Protein: ENSMUSP00000136926
Gene: ENSMUSG00000090215

DomainStartEndE-ValueType
RING 15 58 7.8e-7 SMART
ZnF_RBZ 31 61 5.96e-1 SMART
BBOX 91 132 2.15e-9 SMART
low complexity region 195 209 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184402
Meta Mutation Damage Score 0.534 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dlx4 T G 11: 95,141,229 M240L probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Mkrn1 A G 6: 39,399,275 W466R probably benign Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc12a1 A G 2: 125,219,762 R958G probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spag4 T C 2: 156,068,042 V302A probably damaging Het
Spire2 A C 8: 123,358,097 probably benign Het
Sptbn2 G T 19: 4,724,744 V142L probably damaging Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Trim12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Trim12c APN 7 104348215 missense possibly damaging 0.81
IGL01645:Trim12c APN 7 104345054 nonsense probably null
IGL01737:Trim12c APN 7 104348062 missense probably damaging 1.00
IGL02184:Trim12c APN 7 104348223 missense probably benign 0.00
IGL02309:Trim12c APN 7 104344956 missense possibly damaging 0.72
IGL02323:Trim12c APN 7 104348266 missense probably benign 0.00
IGL02656:Trim12c APN 7 104341203 missense probably damaging 1.00
R0554:Trim12c UTSW 7 104344962 missense probably damaging 0.96
R1480:Trim12c UTSW 7 104348244 missense probably damaging 1.00
R1501:Trim12c UTSW 7 104340888 unclassified probably benign
R2058:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R2059:Trim12c UTSW 7 104348191 missense possibly damaging 0.81
R3838:Trim12c UTSW 7 104340868 unclassified probably benign
R3870:Trim12c UTSW 7 104348337 missense probably benign 0.00
R4896:Trim12c UTSW 7 104340948 missense probably damaging 0.99
R6288:Trim12c UTSW 7 104346729 missense probably benign 0.19
R6522:Trim12c UTSW 7 104348324 missense probably benign 0.38
R6562:Trim12c UTSW 7 104345134 splice site probably null
R6801:Trim12c UTSW 7 104348130 missense probably damaging 1.00
R7016:Trim12c UTSW 7 104348206 missense
X0062:Trim12c UTSW 7 104346680 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACCCTGCAAGTAAACAGGCAAATG -3'
(R):5'- GTTCAGGTGACGCTGGTTCAAAAC -3'

Sequencing Primer
(F):5'- CAGGCAAATGTTAAGAGTCTGGC -3'
(R):5'- AAACTCTCATGAAGGTGTCCTGG -3'
Posted On2013-04-11