Incidental Mutation 'R1913:Ifnar2'
ID214622
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Nameinterferon (alpha and beta) receptor 2
SynonymsIfnar-2
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location91372783-91405589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91404170 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 433 (V433A)
Ref Sequence ENSEMBL: ENSMUSP00000023693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023691] [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000156133]
Predicted Effect probably benign
Transcript: ENSMUST00000023691
SMART Domains Protein: ENSMUSP00000023691
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
FN3 23 100 4.6e-2 SMART
FN3 114 204 7.1e-3 SMART
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023693
AA Change: V433A

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971
AA Change: V433A

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089042
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137612
Predicted Effect probably benign
Transcript: ENSMUST00000144215
SMART Domains Protein: ENSMUSP00000120485
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
Pfam:Tissue_fac 7 65 1.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152729
Predicted Effect probably benign
Transcript: ENSMUST00000156133
SMART Domains Protein: ENSMUSP00000120227
Gene: ENSMUSG00000022969

DomainStartEndE-ValueType
low complexity region 39 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160764
SMART Domains Protein: ENSMUSP00000123997
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
FN3 2 92 5.1e1 SMART
FN3 110 187 9.09e0 SMART
FN3 201 291 1.39e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161517
SMART Domains Protein: ENSMUSP00000125579
Gene: ENSMUSG00000093701

DomainStartEndE-ValueType
Pfam:Interfer-bind 1 100 7.5e-20 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Ahnak T A 19: 9,007,922 V2190E probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91391711 unclassified probably benign
IGL02817:Ifnar2 APN 16 91387992 missense probably benign 0.01
macro-2 UTSW 16 91383899 start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91404229 missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91403921 missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91399265 missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91391867 missense probably benign 0.00
R3078:Ifnar2 UTSW 16 91386001 missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91404344 missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91391796 missense probably benign
R5385:Ifnar2 UTSW 16 91404198 missense possibly damaging 0.70
R5545:Ifnar2 UTSW 16 91385025 critical splice donor site probably null
R5645:Ifnar2 UTSW 16 91404227 missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91387988 missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91388098 missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91393883 missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91393878 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGATCCCCTGCATGAAGAAG -3'
(R):5'- AGTCCATAGATCCTGGGAAGG -3'

Sequencing Primer
(F):5'- TTCAGGCGCTGAGGAATC -3'
(R):5'- CCATAGATCCTGGGAAGGAAGGC -3'
Posted On2014-07-14