Incidental Mutation 'R1913:Ahnak'
ID214638
Institutional Source Beutler Lab
Gene Symbol Ahnak
Ensembl Gene ENSMUSG00000069833
Gene NameAHNAK nucleoprotein (desmoyokin)
Synonyms1110004P15Rik, 2310047C17Rik, DY6
MMRRC Submission 039931-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R1913 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8989284-9076919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9007922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 2190 (V2190E)
Ref Sequence ENSEMBL: ENSMUSP00000090633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]
Predicted Effect probably benign
Transcript: ENSMUST00000092955
SMART Domains Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092956
AA Change: V2190E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: V2190E

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDZ 20 91 2.31e-5 SMART
internal_repeat_2 163 1515 5.22e-182 PROSPERO
internal_repeat_1 224 2314 N/A PROSPERO
internal_repeat_2 1532 3028 5.22e-182 PROSPERO
internal_repeat_1 2660 5095 N/A PROSPERO
low complexity region 5336 5353 N/A INTRINSIC
low complexity region 5493 5504 N/A INTRINSIC
low complexity region 5580 5600 N/A INTRINSIC
low complexity region 5620 5636 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik T G 5: 9,266,275 L2R probably damaging Het
Abca16 A T 7: 120,541,240 I1588F probably benign Het
Abcc2 A T 19: 43,807,244 T480S probably benign Het
Acnat1 A G 4: 49,447,498 I361T probably damaging Het
Adamts10 A T 17: 33,549,555 H869L probably benign Het
AF366264 T A 8: 13,837,143 Q316L probably benign Het
Agpat5 T C 8: 18,879,613 C253R probably benign Het
Agtrap T A 4: 148,083,977 H15L probably damaging Het
Alx4 A G 2: 93,675,387 E278G probably damaging Het
Amz2 T C 11: 109,428,871 S28P probably damaging Het
Atr T A 9: 95,866,733 Y444N probably benign Het
Brdt T C 5: 107,348,613 I197T probably benign Het
Ccser1 G T 6: 62,379,894 S772I probably damaging Het
Cdh16 T C 8: 104,616,468 H657R probably benign Het
Ceacam5 A T 7: 17,759,577 K842* probably null Het
Cep120 G A 18: 53,723,286 T353I probably benign Het
Chrnb1 T C 11: 69,793,584 N164S possibly damaging Het
Cse1l T C 2: 166,922,191 F123L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dcx G C X: 143,923,103 L231V probably damaging Het
Dnah12 T C 14: 26,792,264 probably null Het
Dnah2 A T 11: 69,464,930 M2227K probably damaging Het
Dnajc30 G A 5: 135,064,332 A28T probably benign Het
Dnm1l T C 16: 16,329,966 T306A probably benign Het
Enpp3 C A 10: 24,776,771 E763* probably null Het
Esyt3 T C 9: 99,320,311 S516G probably benign Het
Exoc3 T C 13: 74,182,316 Q498R probably damaging Het
Fbn2 T A 18: 58,061,742 N1449I probably damaging Het
Fgb T C 3: 83,044,980 D194G probably benign Het
Fgd3 T C 13: 49,263,848 D713G possibly damaging Het
Foxb1 T A 9: 69,760,101 Y49F possibly damaging Het
Fpr3 A G 17: 17,971,408 I314V probably damaging Het
Gfod1 A T 13: 43,303,445 I18N probably damaging Het
Gm11492 T C 11: 87,567,012 S71P probably benign Het
Gm5407 T C 16: 49,296,920 noncoding transcript Het
Gm7534 A G 4: 134,192,675 probably null Het
Gpr89 A G 3: 96,875,633 F334L possibly damaging Het
Gucy2d G T 7: 98,443,847 V144F probably benign Het
H2-Bl T A 17: 36,081,016 K237M probably damaging Het
H2-M10.5 C A 17: 36,774,768 P273H probably damaging Het
Hcn2 A G 10: 79,730,943 M485V probably benign Het
Helz2 G T 2: 181,233,750 S1650R probably damaging Het
Ifnar2 T C 16: 91,404,170 V433A probably benign Het
Igsf21 T A 4: 140,107,312 Y83F probably benign Het
Kcnk18 A G 19: 59,235,058 I212V possibly damaging Het
Kcns2 T C 15: 34,839,709 I406T probably damaging Het
Krt42 C T 11: 100,267,249 V166M possibly damaging Het
Lama3 T C 18: 12,495,279 M1476T probably benign Het
Lcor A G 19: 41,558,474 R166G probably benign Het
Mapt C T 11: 104,328,075 P354L probably damaging Het
Mep1b A T 18: 21,093,229 I383F probably benign Het
Mpzl1 C A 1: 165,601,805 C222F probably benign Het
Mug2 T C 6: 122,070,870 L780P probably damaging Het
Naip2 C T 13: 100,152,157 probably null Het
Ndufab1 T C 7: 122,096,691 D41G probably benign Het
Ntn1 A G 11: 68,213,185 C546R probably damaging Het
Olfr448 T A 6: 42,896,753 F101I probably damaging Het
Pakap A G 4: 57,892,963 E880G probably damaging Het
Pde6b A G 5: 108,427,190 E639G probably benign Het
Phf10 T C 17: 14,956,809 T83A probably benign Het
Phkb T A 8: 85,901,920 I186N possibly damaging Het
Pkhd1 A G 1: 20,566,756 probably null Het
Plxnd1 C A 6: 115,978,017 A595S possibly damaging Het
Ppara T A 15: 85,801,099 H416Q probably damaging Het
Prodh T A 16: 18,081,027 D188V probably damaging Het
Psmd14 A T 2: 61,785,456 K223M possibly damaging Het
Ptpn5 A G 7: 47,078,868 M528T possibly damaging Het
Rassf9 G A 10: 102,544,939 E59K probably benign Het
Rnf2 A T 1: 151,476,185 L140H probably damaging Het
Scai A G 2: 39,080,081 F557S probably damaging Het
Sdk2 A G 11: 113,856,726 S653P possibly damaging Het
Sec24c A G 14: 20,689,111 D534G probably benign Het
Serinc1 A G 10: 57,519,465 V375A probably benign Het
Serpinb9f C T 13: 33,325,846 A7V probably damaging Het
Smco1 T C 16: 32,273,882 S124P probably damaging Het
Smim23 C A 11: 32,824,441 C26F possibly damaging Het
Sppl2c T A 11: 104,187,889 M505K probably benign Het
Sprr1b C A 3: 92,437,468 V34F possibly damaging Het
Sun1 G A 5: 139,235,732 probably null Het
Supt16 A G 14: 52,178,135 L381P possibly damaging Het
Syne2 A G 12: 75,899,246 D364G possibly damaging Het
Tax1bp1 G T 6: 52,765,952 V775F probably damaging Het
Tial1 T A 7: 128,444,659 I231F probably damaging Het
Tiam1 C A 16: 89,798,694 V1300L probably damaging Het
Tmem132e A G 11: 82,443,417 T585A probably damaging Het
Tnni3k C T 3: 154,979,199 A165T probably benign Het
Tomm40 A T 7: 19,710,961 I165N probably damaging Het
Tomt T C 7: 101,901,247 E104G probably damaging Het
Topaz1 T C 9: 122,767,013 S950P possibly damaging Het
Traf3ip2 C G 10: 39,625,940 P28R probably benign Het
Trim24 C T 6: 37,957,815 P822S probably damaging Het
Upf3a T G 8: 13,792,108 Y175D probably damaging Het
Vars2 G A 17: 35,666,922 P69S probably benign Het
Veph1 T C 3: 66,244,555 Y151C probably damaging Het
Vmn2r11 T A 5: 109,054,788 D141V probably benign Het
Vwa5b1 G A 4: 138,592,020 Q442* probably null Het
Wdr17 T A 8: 54,687,726 D197V probably damaging Het
Wdr70 G T 15: 7,884,410 T586N possibly damaging Het
Wfdc18 G A 11: 83,709,928 G52R probably benign Het
Zc3h6 T C 2: 129,016,620 I857T probably damaging Het
Zfp318 TGAAGAAGAAGAAGAAGAAGAAGAAGAAG TGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAG 17: 46,412,514 probably benign Het
Zfp318 GAAGAA GAAGAACAAGAA 17: 46,412,524 probably benign Het
Zfp647 C T 15: 76,911,951 V170I probably benign Het
Zfp871 T C 17: 32,775,917 N76D possibly damaging Het
Zwilch A G 9: 64,160,952 Y194H probably damaging Het
Other mutations in Ahnak
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ahnak APN 19 9007223 missense probably damaging 0.99
IGL00509:Ahnak APN 19 9009951 missense possibly damaging 0.94
IGL00539:Ahnak APN 19 9007908 missense possibly damaging 0.50
IGL00558:Ahnak APN 19 9004307 missense possibly damaging 0.93
IGL00567:Ahnak APN 19 9013383 missense probably benign 0.24
IGL00706:Ahnak APN 19 9013730 nonsense probably null
IGL00807:Ahnak APN 19 9008522 missense possibly damaging 0.92
IGL00870:Ahnak APN 19 9013698 missense probably damaging 1.00
IGL01101:Ahnak APN 19 9012887 intron probably benign
IGL01118:Ahnak APN 19 9012578 missense probably damaging 1.00
IGL01288:Ahnak APN 19 9002494 missense possibly damaging 0.94
IGL01324:Ahnak APN 19 9003032 missense probably damaging 1.00
IGL01341:Ahnak APN 19 9011703 missense probably benign
IGL01541:Ahnak APN 19 9007879 missense possibly damaging 0.95
IGL01580:Ahnak APN 19 9002839 missense probably benign 0.02
IGL01595:Ahnak APN 19 9003501 nonsense probably null
IGL01746:Ahnak APN 19 9004912 missense possibly damaging 0.89
IGL01766:Ahnak APN 19 9000118 missense unknown
IGL01821:Ahnak APN 19 9012118 missense probably benign
IGL01913:Ahnak APN 19 9006064 nonsense probably null
IGL01934:Ahnak APN 19 9002657 missense probably damaging 1.00
IGL01940:Ahnak APN 19 9006557 missense probably benign 0.14
IGL01958:Ahnak APN 19 9014909 missense possibly damaging 0.59
IGL02145:Ahnak APN 19 9002855 missense probably benign 0.11
IGL02246:Ahnak APN 19 9008268 missense probably damaging 1.00
IGL02282:Ahnak APN 19 9005987 missense probably damaging 1.00
IGL02428:Ahnak APN 19 9014833 missense possibly damaging 0.83
IGL02442:Ahnak APN 19 9004016 missense probably damaging 1.00
IGL02474:Ahnak APN 19 9004933 missense probably benign 0.13
IGL02483:Ahnak APN 19 9003308 missense probably benign 0.01
IGL02616:Ahnak APN 19 9005627 missense probably benign 0.03
IGL02630:Ahnak APN 19 9012077 missense probably damaging 1.00
IGL02690:Ahnak APN 19 9012584 nonsense probably null
IGL02717:Ahnak APN 19 9002387 missense probably benign 0.00
IGL02721:Ahnak APN 19 9009707 missense probably benign 0.07
IGL02737:Ahnak APN 19 9004593 missense probably benign 0.17
IGL02850:Ahnak APN 19 9002596 missense probably benign 0.00
IGL03071:Ahnak APN 19 9011918 missense possibly damaging 0.63
IGL03072:Ahnak APN 19 9006508 missense probably benign 0.11
IGL03094:Ahnak APN 19 9003547 missense possibly damaging 0.64
IGL03140:Ahnak APN 19 9005212 intron probably benign
IGL03176:Ahnak APN 19 9008166 missense possibly damaging 0.56
IGL03176:Ahnak APN 19 9002449 missense probably damaging 1.00
IGL03189:Ahnak APN 19 9011239 missense possibly damaging 0.65
IGL03357:Ahnak APN 19 9009325 intron probably benign
IGL03371:Ahnak APN 19 9004228 missense possibly damaging 0.91
Eskimo UTSW 19 9009574 missense probably benign 0.31
IGL03097:Ahnak UTSW 19 9002387 missense probably benign 0.00
R0054:Ahnak UTSW 19 9012056 missense probably damaging 1.00
R0094:Ahnak UTSW 19 9013893 missense probably benign 0.12
R0110:Ahnak UTSW 19 9018232 nonsense probably null
R0141:Ahnak UTSW 19 9006680 missense probably damaging 1.00
R0166:Ahnak UTSW 19 9005725 missense probably damaging 1.00
R0309:Ahnak UTSW 19 9002495 missense probably damaging 1.00
R0368:Ahnak UTSW 19 9008350 nonsense probably null
R0386:Ahnak UTSW 19 9011144 missense possibly damaging 0.94
R0401:Ahnak UTSW 19 9015116 missense probably benign 0.24
R0415:Ahnak UTSW 19 9012871 intron probably benign
R0463:Ahnak UTSW 19 9009407 intron probably benign
R0469:Ahnak UTSW 19 9018232 nonsense probably null
R0470:Ahnak UTSW 19 9008967 missense probably benign 0.29
R0487:Ahnak UTSW 19 9007151 missense probably benign 0.00
R0487:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R0499:Ahnak UTSW 19 9000264 splice site probably benign
R0506:Ahnak UTSW 19 9009128 missense probably damaging 1.00
R0510:Ahnak UTSW 19 9018232 nonsense probably null
R0557:Ahnak UTSW 19 9001944 missense probably benign 0.10
R0570:Ahnak UTSW 19 9013698 missense probably damaging 1.00
R0610:Ahnak UTSW 19 9007878 missense probably benign 0.08
R0646:Ahnak UTSW 19 9013402 nonsense probably null
R0659:Ahnak UTSW 19 9015002 missense possibly damaging 0.60
R0791:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0792:Ahnak UTSW 19 9016734 missense probably benign 0.01
R0840:Ahnak UTSW 19 9005063 missense probably damaging 1.00
R0847:Ahnak UTSW 19 9006433 nonsense probably null
R0941:Ahnak UTSW 19 9009914 missense probably damaging 1.00
R0962:Ahnak UTSW 19 9012848 intron probably benign
R1017:Ahnak UTSW 19 9010543 missense probably damaging 0.99
R1037:Ahnak UTSW 19 9007618 missense probably benign 0.27
R1085:Ahnak UTSW 19 9013125 missense possibly damaging 0.50
R1113:Ahnak UTSW 19 9005620 missense probably benign 0.29
R1140:Ahnak UTSW 19 9004245 missense probably damaging 1.00
R1158:Ahnak UTSW 19 9013926 missense probably benign 0.00
R1218:Ahnak UTSW 19 9015619 missense probably damaging 1.00
R1225:Ahnak UTSW 19 9002883 missense probably damaging 1.00
R1245:Ahnak UTSW 19 9004169 missense probably benign 0.44
R1421:Ahnak UTSW 19 9015631 missense possibly damaging 0.95
R1447:Ahnak UTSW 19 9007082 missense probably damaging 0.98
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1464:Ahnak UTSW 19 9004896 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1466:Ahnak UTSW 19 9015875 missense probably damaging 1.00
R1471:Ahnak UTSW 19 9012932 intron probably benign
R1507:Ahnak UTSW 19 9010077 missense probably damaging 1.00
R1521:Ahnak UTSW 19 9004728 missense probably benign 0.11
R1568:Ahnak UTSW 19 9002375 missense probably damaging 0.98
R1569:Ahnak UTSW 19 9004094 missense possibly damaging 0.78
R1616:Ahnak UTSW 19 9008987 missense possibly damaging 0.94
R1638:Ahnak UTSW 19 9009449 missense probably benign 0.01
R1680:Ahnak UTSW 19 9009963 missense probably benign 0.05
R1713:Ahnak UTSW 19 9011809 missense possibly damaging 0.95
R1722:Ahnak UTSW 19 9010655 missense probably damaging 0.99
R1771:Ahnak UTSW 19 9013753 missense probably benign 0.24
R1795:Ahnak UTSW 19 9002438 missense possibly damaging 0.79
R1823:Ahnak UTSW 19 9004905 missense probably damaging 0.99
R1842:Ahnak UTSW 19 9005867 missense probably damaging 0.99
R1854:Ahnak UTSW 19 9013832 missense possibly damaging 0.61
R1856:Ahnak UTSW 19 9002048 missense possibly damaging 0.86
R1886:Ahnak UTSW 19 9015979 missense probably damaging 0.98
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1888:Ahnak UTSW 19 9007088 missense probably damaging 1.00
R1912:Ahnak UTSW 19 9017881 missense probably damaging 1.00
R1942:Ahnak UTSW 19 9015083 missense probably damaging 0.98
R1987:Ahnak UTSW 19 9015251 missense probably damaging 1.00
R2006:Ahnak UTSW 19 9007075 missense probably damaging 1.00
R2013:Ahnak UTSW 19 9014573 missense probably damaging 0.98
R2014:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R2047:Ahnak UTSW 19 9014300 missense possibly damaging 0.67
R2048:Ahnak UTSW 19 9007056 missense probably damaging 0.99
R2060:Ahnak UTSW 19 9008041 missense probably benign 0.08
R2083:Ahnak UTSW 19 9011557 missense probably damaging 1.00
R2157:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R2167:Ahnak UTSW 19 9011494 nonsense probably null
R2208:Ahnak UTSW 19 9017732 missense probably benign 0.00
R2224:Ahnak UTSW 19 9012991 intron probably benign
R2268:Ahnak UTSW 19 9010574 missense possibly damaging 0.66
R2420:Ahnak UTSW 19 9009256 missense possibly damaging 0.89
R2426:Ahnak UTSW 19 9002851 missense possibly damaging 0.81
R2910:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2911:Ahnak UTSW 19 9011654 missense probably damaging 0.99
R2981:Ahnak UTSW 19 9000148 missense probably damaging 0.97
R3151:Ahnak UTSW 19 9009944 missense probably benign 0.12
R3155:Ahnak UTSW 19 9010177 missense possibly damaging 0.49
R3422:Ahnak UTSW 19 9005708 missense probably benign 0.39
R3422:Ahnak UTSW 19 9006752 missense probably benign 0.05
R3430:Ahnak UTSW 19 9006958 missense probably benign 0.42
R3433:Ahnak UTSW 19 9009994 missense probably benign 0.01
R3711:Ahnak UTSW 19 9007898 missense probably benign
R3723:Ahnak UTSW 19 9016853 missense possibly damaging 0.79
R3775:Ahnak UTSW 19 9009023 missense possibly damaging 0.91
R3858:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3859:Ahnak UTSW 19 9010859 missense possibly damaging 0.82
R3922:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3924:Ahnak UTSW 19 9006328 missense probably benign 0.20
R3926:Ahnak UTSW 19 9006328 missense probably benign 0.20
R4026:Ahnak UTSW 19 9011299 missense probably damaging 0.97
R4051:Ahnak UTSW 19 9014327 missense probably damaging 1.00
R4209:Ahnak UTSW 19 9002600 missense probably damaging 1.00
R4234:Ahnak UTSW 19 9000786 nonsense probably null
R4237:Ahnak UTSW 19 9001783 missense probably benign 0.02
R4285:Ahnak UTSW 19 9016839 nonsense probably null
R4331:Ahnak UTSW 19 9015820 missense probably damaging 1.00
R4342:Ahnak UTSW 19 9012083 missense possibly damaging 0.79
R4430:Ahnak UTSW 19 9003040 missense probably benign 0.00
R4554:Ahnak UTSW 19 9014930 missense probably damaging 1.00
R4602:Ahnak UTSW 19 9010825 missense possibly damaging 0.66
R4612:Ahnak UTSW 19 9003724 missense probably benign 0.44
R4655:Ahnak UTSW 19 9008701 missense probably damaging 1.00
R4656:Ahnak UTSW 19 9004855 missense possibly damaging 0.80
R4700:Ahnak UTSW 19 9004681 missense probably benign 0.02
R4704:Ahnak UTSW 19 9012258 intron probably benign
R4704:Ahnak UTSW 19 9013181 missense probably damaging 0.99
R4705:Ahnak UTSW 19 9016906 missense probably benign 0.07
R4707:Ahnak UTSW 19 9016735 missense probably benign 0.03
R4732:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4733:Ahnak UTSW 19 9007301 missense probably damaging 1.00
R4778:Ahnak UTSW 19 9011975 missense possibly damaging 0.79
R4782:Ahnak UTSW 19 9012499 intron probably benign
R4832:Ahnak UTSW 19 9012460 intron probably benign
R4882:Ahnak UTSW 19 9005897 missense probably damaging 0.98
R4884:Ahnak UTSW 19 9012754 intron probably benign
R4895:Ahnak UTSW 19 9017441 missense probably benign 0.43
R4930:Ahnak UTSW 19 9010967 missense possibly damaging 0.79
R4951:Ahnak UTSW 19 9017835 missense probably damaging 1.00
R4968:Ahnak UTSW 19 9015100 missense probably damaging 1.00
R5026:Ahnak UTSW 19 9010631 missense possibly damaging 0.46
R5050:Ahnak UTSW 19 9012458 intron probably benign
R5073:Ahnak UTSW 19 9003231 missense probably benign 0.42
R5110:Ahnak UTSW 19 9014759 missense probably damaging 1.00
R5119:Ahnak UTSW 19 9013644 missense probably benign 0.00
R5128:Ahnak UTSW 19 9017087 missense probably damaging 1.00
R5139:Ahnak UTSW 19 9004655 missense probably damaging 1.00
R5150:Ahnak UTSW 19 9010904 missense possibly damaging 0.46
R5151:Ahnak UTSW 19 9017569 missense probably benign 0.03
R5165:Ahnak UTSW 19 9015665 missense possibly damaging 0.95
R5236:Ahnak UTSW 19 9000684 missense possibly damaging 0.92
R5361:Ahnak UTSW 19 9015341 missense possibly damaging 0.92
R5366:Ahnak UTSW 19 9016735 missense possibly damaging 0.65
R5387:Ahnak UTSW 19 9003691 missense probably damaging 1.00
R5396:Ahnak UTSW 19 9007175 missense probably damaging 0.99
R5583:Ahnak UTSW 19 9006917 missense probably damaging 0.99
R5587:Ahnak UTSW 19 9009476 missense possibly damaging 0.88
R5620:Ahnak UTSW 19 9013094 nonsense probably null
R5643:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5644:Ahnak UTSW 19 9010657 missense possibly damaging 0.66
R5657:Ahnak UTSW 19 9014615 missense probably damaging 0.99
R5688:Ahnak UTSW 19 9002519 missense probably benign 0.01
R5702:Ahnak UTSW 19 9001840 missense probably damaging 1.00
R5727:Ahnak UTSW 19 9016747 missense probably damaging 0.99
R5730:Ahnak UTSW 19 9010253 missense possibly damaging 0.81
R5755:Ahnak UTSW 19 9001732 missense probably benign 0.06
R5760:Ahnak UTSW 19 9013562 missense probably damaging 1.00
R5789:Ahnak UTSW 19 9002321 missense probably benign 0.00
R5790:Ahnak UTSW 19 9015248 missense probably damaging 0.99
R5795:Ahnak UTSW 19 9012382 nonsense probably null
R5808:Ahnak UTSW 19 9010235 missense possibly damaging 0.91
R5867:Ahnak UTSW 19 9010052 missense probably damaging 0.99
R5878:Ahnak UTSW 19 9008342 missense probably damaging 1.00
R5898:Ahnak UTSW 19 9013767 missense possibly damaging 0.63
R5898:Ahnak UTSW 19 9018211 missense probably damaging 1.00
R5912:Ahnak UTSW 19 9011903 missense probably damaging 0.99
R5935:Ahnak UTSW 19 9015182 missense possibly damaging 0.91
R5969:Ahnak UTSW 19 9016585 missense probably damaging 1.00
R5988:Ahnak UTSW 19 9009347 intron probably benign
R6000:Ahnak UTSW 19 9013111 nonsense probably null
R6005:Ahnak UTSW 19 9015161 missense possibly damaging 0.61
R6101:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6105:Ahnak UTSW 19 9004099 missense probably benign 0.20
R6116:Ahnak UTSW 19 9012963 intron probably benign
R6209:Ahnak UTSW 19 9012566 missense probably damaging 1.00
R6240:Ahnak UTSW 19 9013583 missense probably damaging 1.00
R6255:Ahnak UTSW 19 9008025 missense possibly damaging 0.95
R6263:Ahnak UTSW 19 9018277 missense probably benign 0.03
R6287:Ahnak UTSW 19 9015003 missense probably benign 0.02
R6296:Ahnak UTSW 19 9003305 missense probably damaging 0.99
R6315:Ahnak UTSW 19 9006626 missense probably damaging 0.99
R6328:Ahnak UTSW 19 9007148 missense probably benign 0.11
R6331:Ahnak UTSW 19 9006625 missense probably benign 0.18
R6355:Ahnak UTSW 19 9008762 missense probably benign 0.02
R6409:Ahnak UTSW 19 9009574 missense probably benign 0.31
R6567:Ahnak UTSW 19 9008806 missense probably benign 0.27
R6572:Ahnak UTSW 19 9007976 missense probably damaging 0.99
R6574:Ahnak UTSW 19 9017047 missense probably benign 0.04
R6593:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6620:Ahnak UTSW 19 9015310 missense possibly damaging 0.95
R6690:Ahnak UTSW 19 9009581 missense probably benign 0.29
R6731:Ahnak UTSW 19 9011562 missense possibly damaging 0.85
R6756:Ahnak UTSW 19 9007561 missense possibly damaging 0.59
R6846:Ahnak UTSW 19 9011857 missense possibly damaging 0.66
R6854:Ahnak UTSW 19 9015235 missense probably damaging 1.00
R6857:Ahnak UTSW 19 9037168 nonsense probably null
R6863:Ahnak UTSW 19 9012365 intron probably benign
R6876:Ahnak UTSW 19 9014120 missense probably damaging 0.99
R6958:Ahnak UTSW 19 9015215 missense possibly damaging 0.88
X0021:Ahnak UTSW 19 9013619 missense probably damaging 0.99
X0027:Ahnak UTSW 19 9012037 missense probably damaging 1.00
Z1088:Ahnak UTSW 19 9016082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGTGTGGATGTGGAAGTACC -3'
(R):5'- ATCAATGTCCACCTTGGGTCC -3'

Sequencing Primer
(F):5'- ACCTGATGTTGATCTGGAATGTCC -3'
(R):5'- ACATCAATGTCAGCCTTGGG -3'
Posted On2014-07-14