Incidental Mutation 'R0127:Dlx4'
ID21467
Institutional Source Beutler Lab
Gene Symbol Dlx4
Ensembl Gene ENSMUSG00000020871
Gene Namedistal-less homeobox 4
SynonymsDlx7, Dlx-4, DII D
MMRRC Submission 038412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R0127 (G1)
Quality Score106
Status Validated (trace)
Chromosome11
Chromosomal Location95140447-95146263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95141229 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 240 (M240L)
Ref Sequence ENSEMBL: ENSMUSP00000021241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021241]
Predicted Effect probably benign
Transcript: ENSMUST00000021241
AA Change: M240L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021241
Gene: ENSMUSG00000020871
AA Change: M240L

DomainStartEndE-ValueType
low complexity region 92 104 N/A INTRINSIC
HOX 116 178 1.22e-21 SMART
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156477
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.9%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many vertebrate homeo box-containing genes have been identified on the basis of their sequence similarity with Drosophila developmental genes. Members of the Dlx gene family contain a homeobox that is related to that of Distal-less (Dll), a gene expressed in the head and limbs of the developing fruit fly. The Distal-less (Dlx) family of genes comprises at least 6 different members, DLX1-DLX6. The DLX proteins are postulated to play a role in forebrain and craniofacial development. Three transcript variants have been described for this gene, however, the full length nature of one variant has not been described. Studies of the two splice variants revealed that one encoded isoform functions as a repressor of the beta-globin gene while the other isoform lacks that function. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,454 T152A probably benign Het
Abca1 T C 4: 53,067,155 I1351V probably benign Het
Acap1 A T 11: 69,887,217 probably benign Het
Als2cl T C 9: 110,891,867 L521P probably damaging Het
Ankrd50 T C 3: 38,456,235 D661G probably benign Het
Atp6v1b2 T A 8: 69,103,460 N262K probably damaging Het
Baz1a T A 12: 54,898,706 D1288V possibly damaging Het
Bbs1 A T 19: 4,895,029 D371E probably benign Het
Bphl A G 13: 34,064,046 probably benign Het
Caskin2 C A 11: 115,800,994 R988S probably damaging Het
Cbr1 C A 16: 93,609,987 T197N probably damaging Het
Ccdc88c T C 12: 100,935,740 E1213G possibly damaging Het
Ccna1 A G 3: 55,049,748 F83L probably damaging Het
Cep290 T A 10: 100,536,925 probably benign Het
Cep89 C A 7: 35,428,262 T543K possibly damaging Het
Cmtm7 T C 9: 114,781,670 M45V probably benign Het
Col16a1 T A 4: 130,052,857 V91E probably damaging Het
Csmd3 T C 15: 47,981,930 N920S probably benign Het
Cyp26b1 A G 6: 84,577,208 probably benign Het
Dao T A 5: 114,019,963 H215Q probably damaging Het
Dido1 T C 2: 180,671,824 D885G probably benign Het
Dnah5 C T 15: 28,294,925 P1351L probably damaging Het
Dnah6 T A 6: 73,038,734 probably benign Het
Dock5 A T 14: 67,846,042 D139E probably benign Het
Fam234b T C 6: 135,218,823 probably benign Het
Fat2 T C 11: 55,289,286 T1410A probably benign Het
Fsip2 T A 2: 82,984,925 N3667K probably benign Het
Gm14085 T A 2: 122,517,069 probably null Het
Gm5114 T C 7: 39,408,456 I580V probably benign Het
Hapln1 A T 13: 89,607,869 Y264F probably benign Het
Heatr5a A G 12: 51,925,405 V694A probably benign Het
Hps1 A G 19: 42,771,111 probably benign Het
Igsf9b G T 9: 27,334,385 R1216L possibly damaging Het
Il4ra G T 7: 125,569,070 C87F probably damaging Het
Kmt5b A G 19: 3,786,465 M1V probably null Het
Krit1 A G 5: 3,822,178 E401G probably damaging Het
Lamp1 T C 8: 13,174,491 V385A probably damaging Het
Ly6g5b A G 17: 35,114,591 Y82H probably damaging Het
Mapre2 A G 18: 23,804,175 I25V probably benign Het
Mep1a A G 17: 43,497,886 probably benign Het
Mgea5 A T 19: 45,771,888 I277N probably damaging Het
Mkrn1 A G 6: 39,399,275 W466R probably benign Het
Muc2 C A 7: 141,748,954 F11L probably benign Het
Nebl T A 2: 17,392,983 M501L probably benign Het
Olfr1151 A G 2: 87,857,483 I103V probably benign Het
Olfr1179 A G 2: 88,402,355 V193A probably benign Het
Olfr744 A G 14: 50,618,332 I37V probably benign Het
Olfr951 A G 9: 39,393,942 I50M probably benign Het
Pkd1l2 A G 8: 117,050,048 probably benign Het
Pkhd1l1 A G 15: 44,554,605 M2886V probably damaging Het
Pop5 T A 5: 115,240,171 L58H probably damaging Het
Prkch C A 12: 73,721,787 H444N possibly damaging Het
Reln T C 5: 22,004,136 D1148G probably damaging Het
Rffl G A 11: 82,812,632 T120M probably damaging Het
Rmdn2 A T 17: 79,670,569 S320C probably damaging Het
Rrbp1 C T 2: 143,989,944 R101H probably benign Het
Rtf1 G A 2: 119,726,743 R443H probably damaging Het
Serac1 G T 17: 6,048,840 L559I probably damaging Het
Slc12a1 A G 2: 125,219,762 R958G probably damaging Het
Slc15a3 T A 19: 10,855,986 W456R probably damaging Het
Slc35f5 C T 1: 125,576,205 P290L probably damaging Het
Slc35g2 C T 9: 100,553,117 R167Q probably benign Het
Spag4 T C 2: 156,068,042 V302A probably damaging Het
Spire2 A C 8: 123,358,097 probably benign Het
Sptbn2 G T 19: 4,724,744 V142L probably damaging Het
Syt17 T A 7: 118,409,941 D352V probably damaging Het
Tarsl2 A T 7: 65,664,969 D425V probably benign Het
Tctex1d1 T C 4: 103,002,452 probably benign Het
Thsd7a A G 6: 12,554,908 S326P probably benign Het
Tnpo2 T C 8: 85,040,628 S64P probably damaging Het
Tonsl G T 15: 76,633,485 A678D probably benign Het
Trim12c A G 7: 104,340,906 probably null Het
Tsc22d1 A G 14: 76,418,981 T885A possibly damaging Het
Ttn T C 2: 76,742,198 D26117G probably damaging Het
Ttn T A 2: 76,877,011 probably benign Het
Ugt3a1 T C 15: 9,306,256 F164L probably benign Het
Vmn2r89 A G 14: 51,455,703 N170S probably damaging Het
Vrk2 G T 11: 26,534,313 probably benign Het
Wt1 C A 2: 105,133,457 D207E probably damaging Het
Zbtb46 G A 2: 181,411,815 A368V probably benign Het
Zc3h13 A T 14: 75,323,254 D428V unknown Het
Zcchc8 C G 5: 123,707,337 G320A probably damaging Het
Znfx1 T C 2: 167,044,210 E810G possibly damaging Het
Other mutations in Dlx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0383:Dlx4 UTSW 11 95145435 missense probably benign 0.33
R6408:Dlx4 UTSW 11 95145252 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGCCCCTGATCTAACTCTCTGC -3'
(R):5'- AGCAAAGGTTCCCAGGACTCACTC -3'

Sequencing Primer
(F):5'- CCTGATCTAACTCTCTGCTTTGG -3'
(R):5'- GATCTGGTTTCAGAACAAACGCTC -3'
Posted On2013-04-11