Incidental Mutation 'R1915:Large2'
ID214746
Institutional Source Beutler Lab
Gene Symbol Large2
Ensembl Gene ENSMUSG00000040434
Gene NameLARGE xylosyl- and glucuronyltransferase 2
Synonyms5730485C17Rik, Gyltl1b
MMRRC Submission 039933-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1915 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92365046-92374869 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 92365825 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044036] [ENSMUST00000068586] [ENSMUST00000068702] [ENSMUST00000090582] [ENSMUST00000090586] [ENSMUST00000111284] [ENSMUST00000111290] [ENSMUST00000111291] [ENSMUST00000111292] [ENSMUST00000111293] [ENSMUST00000111294] [ENSMUST00000111297] [ENSMUST00000148352] [ENSMUST00000176289] [ENSMUST00000176339] [ENSMUST00000176774] [ENSMUST00000176810]
Predicted Effect probably benign
Transcript: ENSMUST00000044036
SMART Domains Protein: ENSMUSP00000038497
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068586
SMART Domains Protein: ENSMUSP00000064128
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 316 4.6e-22 PFAM
low complexity region 392 401 N/A INTRINSIC
Pfam:Glyco_transf_49 402 469 2.2e-11 PFAM
Pfam:Glyco_transf_49 466 673 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068702
SMART Domains Protein: ENSMUSP00000070649
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090582
SMART Domains Protein: ENSMUSP00000088070
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 70 218 7.2e-9 PFAM
Pfam:Glyco_transf_8 188 281 2.3e-8 PFAM
low complexity region 357 366 N/A INTRINSIC
Pfam:Glyco_transf_49 367 434 2.1e-11 PFAM
Pfam:Glyco_transf_49 431 638 9.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090586
SMART Domains Protein: ENSMUSP00000088074
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111284
SMART Domains Protein: ENSMUSP00000106915
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 97 341 8.9e-22 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 494 6.5e-11 PFAM
Pfam:Glyco_transf_49 491 698 3.1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111290
SMART Domains Protein: ENSMUSP00000106921
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 405 417 4.28e-1 SMART
low complexity region 424 436 N/A INTRINSIC
PHD 470 513 3.12e-15 SMART
RING 471 512 1.85e-1 SMART
coiled coil region 537 582 N/A INTRINSIC
low complexity region 630 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111291
SMART Domains Protein: ENSMUSP00000106922
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 165 186 N/A INTRINSIC
AT_hook 350 362 4.28e-1 SMART
low complexity region 369 381 N/A INTRINSIC
PHD 415 458 3.12e-15 SMART
RING 416 457 1.85e-1 SMART
coiled coil region 482 527 N/A INTRINSIC
low complexity region 575 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111292
SMART Domains Protein: ENSMUSP00000106923
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
PHD 367 410 3.12e-15 SMART
RING 368 409 1.85e-1 SMART
coiled coil region 434 479 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111293
SMART Domains Protein: ENSMUSP00000106924
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
AT_hook 434 446 4.28e-1 SMART
low complexity region 453 465 N/A INTRINSIC
PHD 499 542 3.12e-15 SMART
RING 500 541 1.85e-1 SMART
coiled coil region 566 611 N/A INTRINSIC
low complexity region 659 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111294
SMART Domains Protein: ENSMUSP00000106925
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 128 N/A INTRINSIC
low complexity region 249 270 N/A INTRINSIC
PHD 452 495 3.12e-15 SMART
RING 453 494 1.85e-1 SMART
coiled coil region 519 564 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111297
SMART Domains Protein: ENSMUSP00000106928
Gene: ENSMUSG00000058318

DomainStartEndE-ValueType
coiled coil region 29 62 N/A INTRINSIC
low complexity region 85 129 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
PHD 422 465 3.12e-15 SMART
RING 423 464 1.85e-1 SMART
coiled coil region 489 534 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146311
Predicted Effect probably benign
Transcript: ENSMUST00000148352
SMART Domains Protein: ENSMUSP00000135451
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175851
Predicted Effect probably benign
Transcript: ENSMUST00000176289
SMART Domains Protein: ENSMUSP00000135118
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176339
SMART Domains Protein: ENSMUSP00000135619
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
transmembrane domain 31 50 N/A INTRINSIC
low complexity region 74 85 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176646
Predicted Effect probably benign
Transcript: ENSMUST00000176774
SMART Domains Protein: ENSMUSP00000135400
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
Pfam:Glyco_transf_8 71 317 3.9e-22 PFAM
low complexity region 393 402 N/A INTRINSIC
Pfam:Glyco_transf_49 403 470 1.6e-11 PFAM
Pfam:Glyco_transf_49 467 674 7.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176810
SMART Domains Protein: ENSMUSP00000135024
Gene: ENSMUSG00000040434

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 77 88 N/A INTRINSIC
Pfam:Glyco_transf_8 101 342 4.2e-20 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:Glyco_transf_49 427 493 1.3e-13 PFAM
Pfam:Glyco_transf_49 489 698 2.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177273
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 100% (85/85)
MGI Phenotype PHENOTYPE: Null mutant mice are healthy and are indistinguishable from control littermates with respect to body weight and life span when aged up to one year. No increased spontaneous tumor load was observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,210 R852G probably benign Het
Adam2 C A 14: 66,037,557 V576F possibly damaging Het
Afmid T C 11: 117,835,799 F250L possibly damaging Het
Apc2 A T 10: 80,315,867 I2252L probably benign Het
Bcar1 A G 8: 111,715,398 V270A probably damaging Het
Btnl7-ps T A 17: 34,541,645 noncoding transcript Het
Cdkn2aip T C 8: 47,711,926 T251A probably benign Het
Cdx1 A G 18: 61,019,898 V212A probably benign Het
Cep95 C T 11: 106,814,638 T483I probably damaging Het
Cfap100 T C 6: 90,412,347 probably benign Het
Cfap54 A G 10: 92,884,702 V2630A unknown Het
Chia1 T A 3: 106,128,559 N238K probably benign Het
Cldn23 T A 8: 35,825,945 I130F possibly damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Col28a1 A G 6: 8,176,333 F8S probably benign Het
Cpeb3 C T 19: 37,054,265 R579Q probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dbh A G 2: 27,168,222 D134G probably damaging Het
Dcbld1 G T 10: 52,317,035 C292F probably damaging Het
Dlgap5 T C 14: 47,407,773 K304E probably benign Het
Dnajc2 A G 5: 21,781,319 probably null Het
Eps8l2 G A 7: 141,361,852 V650M probably damaging Het
Erlin1 T C 19: 44,059,065 Y139C probably damaging Het
Exoc3 A G 13: 74,173,294 probably null Het
F5 C A 1: 164,182,917 R406S probably damaging Het
Fahd1 A T 17: 24,849,648 W152R possibly damaging Het
Farp2 T A 1: 93,528,702 S36T probably benign Het
Foxs1 A G 2: 152,932,840 C98R probably damaging Het
Gal3st4 T A 5: 138,265,410 K442N probably benign Het
Gm10644 G A 8: 83,933,850 probably benign Het
Gm8674 A T 13: 49,900,853 noncoding transcript Het
Gpr88 G T 3: 116,252,424 S79R possibly damaging Het
Heatr9 T G 11: 83,518,209 I171L possibly damaging Het
Hectd4 A G 5: 121,322,294 T2209A probably benign Het
Hsh2d A G 8: 72,193,521 T21A probably damaging Het
Irf4 A T 13: 30,761,462 Q397L probably benign Het
Itgae T A 11: 73,118,643 probably benign Het
Jrkl A T 9: 13,245,604 D17E possibly damaging Het
Kcna4 T C 2: 107,296,778 V619A probably benign Het
Kcnh6 T A 11: 106,017,444 Y295* probably null Het
Kif1b G A 4: 149,267,216 T263I probably damaging Het
Lcp1 T A 14: 75,199,297 Y28N possibly damaging Het
Man1c1 G C 4: 134,703,438 P11R probably damaging Het
Mccc2 T C 13: 99,948,530 probably null Het
Mlh3 T C 12: 85,261,668 Y1115C probably benign Het
Mlst8 C T 17: 24,477,290 W155* probably null Het
Myh10 T C 11: 68,790,208 L1025P probably damaging Het
Myof T A 19: 37,977,693 N393I probably damaging Het
Nalcn C T 14: 123,302,769 V1140I probably benign Het
Ncald C T 15: 37,397,080 A119T probably benign Het
Nipbl T C 15: 8,343,630 E1044G possibly damaging Het
Nupl1 T C 14: 60,238,531 K279R probably benign Het
Oas1a A T 5: 120,905,813 N85K possibly damaging Het
Olfr1076 A G 2: 86,508,999 D180G probably damaging Het
Olfr738 C T 14: 50,414,341 P266S probably damaging Het
Olfr870 T C 9: 20,171,028 Y181C probably benign Het
Pou2f2 C T 7: 25,100,156 A92T possibly damaging Het
Ppp1r16a T C 15: 76,693,068 L212P probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Ptbp3 A T 4: 59,517,635 L84Q probably damaging Het
Ptgr2 A T 12: 84,302,322 Q145L probably benign Het
Ptpn23 A T 9: 110,386,507 D1396E probably damaging Het
Pudp T C 18: 50,568,207 N152D probably benign Het
Rbm20 T A 19: 53,864,087 L1166Q probably damaging Het
Rictor T G 15: 6,759,572 I223R probably damaging Het
Ripor1 A T 8: 105,616,886 E270D probably damaging Het
Rorc T C 3: 94,391,173 C322R probably damaging Het
Rpgrip1l T C 8: 91,232,924 D1116G probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Sptan1 C G 2: 30,011,036 Q1425E probably benign Het
Srd5a3 G A 5: 76,147,705 V81I probably benign Het
Stk36 T A 1: 74,634,187 S1080T probably benign Het
Sugp2 T A 8: 70,253,660 I790K probably damaging Het
Syde2 T G 3: 146,014,316 Y764* probably null Het
Tmem130 A G 5: 144,737,856 F353S probably damaging Het
Tmem131 T A 1: 36,796,266 K1591N probably damaging Het
Urb2 C A 8: 124,029,798 T748K possibly damaging Het
Uri1 A T 7: 37,961,678 I480K probably damaging Het
Zcchc3 A C 2: 152,413,681 V366G probably benign Het
Zfp292 G A 4: 34,805,100 S2648F possibly damaging Het
Zfp54 T C 17: 21,434,152 Y303H probably benign Het
Zfp729b A G 13: 67,593,220 F319L probably damaging Het
Zfp934 G A 13: 62,517,955 H291Y probably damaging Het
Other mutations in Large2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Large2 APN 2 92366339 missense probably damaging 1.00
IGL01152:Large2 APN 2 92370639 missense probably damaging 1.00
IGL01377:Large2 APN 2 92369331 missense probably damaging 1.00
IGL01764:Large2 APN 2 92367186 splice site probably benign
IGL02016:Large2 APN 2 92369543 missense possibly damaging 0.82
IGL02396:Large2 APN 2 92366323 nonsense probably null
IGL02996:Large2 APN 2 92365928 missense possibly damaging 0.88
IGL03011:Large2 APN 2 92367582 missense probably damaging 1.00
egged UTSW 2 92370508 intron probably benign
P0041:Large2 UTSW 2 92367254 splice site probably benign
R4193:Large2 UTSW 2 92365359 missense probably damaging 1.00
R4239:Large2 UTSW 2 92366605 splice site probably benign
R4580:Large2 UTSW 2 92370612 missense possibly damaging 0.66
R4679:Large2 UTSW 2 92367558 missense probably benign 0.31
R4857:Large2 UTSW 2 92366634 intron probably benign
R4918:Large2 UTSW 2 92366107 intron probably benign
R5050:Large2 UTSW 2 92367779 missense probably benign 0.05
R5237:Large2 UTSW 2 92367142 missense probably benign 0.16
R5264:Large2 UTSW 2 92374743 unclassified probably benign
R5508:Large2 UTSW 2 92369903 missense possibly damaging 0.80
R5999:Large2 UTSW 2 92366058 missense probably benign 0.01
R6077:Large2 UTSW 2 92366570 missense probably benign 0.00
R6167:Large2 UTSW 2 92367088 missense probably benign 0.44
R6218:Large2 UTSW 2 92370636 missense probably damaging 0.99
R6225:Large2 UTSW 2 92366480 missense probably damaging 1.00
R6301:Large2 UTSW 2 92369516 missense probably damaging 1.00
R6376:Large2 UTSW 2 92370508 intron probably benign
R6485:Large2 UTSW 2 92366028 missense probably benign
R6727:Large2 UTSW 2 92370870 utr 5 prime probably benign
R6942:Large2 UTSW 2 92370822 missense probably damaging 0.99
R7051:Large2 UTSW 2 92367022 missense probably damaging 0.97
R7318:Large2 UTSW 2 92366028 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCCAACTCTATGATGTGGGC -3'
(R):5'- CAAGACTGCTTTGGTGGTGC -3'

Sequencing Primer
(F):5'- AACTCTATGATGTGGGCCACCTTG -3'
(R):5'- TTTGAGACCCTACACTACCGG -3'
Posted On2014-07-14