Mutagenetix > Incidental Mutations

Incidental Mutation 'R1915:Rpgrip1l'

214777

Institutional Source

Beutler Lab

Gene Symbol

Rpgrip1l

Ensembl Gene

ENSMUSG00000033282

Gene Name

Rpgrip1-like

Synonyms

Nphp8, fantom, Ftm, 1700047E16Rik

MMRRC Submission

039933-MU

Accession Numbers

NCBI RefSeq: NM_173431.2; MGI: 1920563

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91217030-91313262 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91232924 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1116 (D1116G)

Ref Sequence

ENSEMBL: ENSMUSP00000042702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047783] [ENSMUST00000139113]

Predicted Effect

probably benign
Transcript: ENSMUST00000047783
AA Change: D1116G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000042702
Gene: ENSMUSG00000033282
AA Change: D1116G

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC
coiled coil region	196	268	N/A	INTRINSIC
coiled coil region	299	371	N/A	INTRINSIC
coiled coil region	395	454	N/A	INTRINSIC
coiled coil region	520	556	N/A	INTRINSIC
Pfam:C2-C2_1	597	738	5.8e-61	PFAM
low complexity region	769	778	N/A	INTRINSIC
C2	791	896	1.06e-5	SMART
low complexity region	989	1000	N/A	INTRINSIC
low complexity region	1057	1080	N/A	INTRINSIC
Blast:C2	1098	1223	3e-20	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000139113

SMART Domains

Protein: ENSMUSP00000118230
Gene: ENSMUSG00000033282

Domain	Start	End	E-Value	Type
coiled coil region	56	143	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210538

Meta Mutation Damage Score

0.08

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.4%

Validation Efficiency

100% (85/85)

MGI Phenotype

Strain: 3716208
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can localize to the basal body-centrosome complex or to primary cilia and centrosomes in ciliated cells. The encoded protein has been found to interact with nephrocystin-4. Defects in this gene are a cause of Joubert syndrome type 7 (JBTS7) and Meckel syndrome type 5 (MKS5). [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for a knock-out allele do not survive after birth and show exencephaly, polydactyly, laterality defects, abnormal floor plate induction and neural tube patterning, cleft lip, micro- and anophthalmia, and variable cerebral, renal, and hepatic defects due to primary cilium dysfuntion. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	T	C	11: 110,212,210	R852G	probably benign	Het
Adam2	C	A	14: 66,037,557	V576F	possibly damaging	Het
Afmid	T	C	11: 117,835,799	F250L	possibly damaging	Het
Apc2	A	T	10: 80,315,867	I2252L	probably benign	Het
Bcar1	A	G	8: 111,715,398	V270A	probably damaging	Het
Btnl7-ps	T	A	17: 34,541,645		noncoding transcript	Het
Cdkn2aip	T	C	8: 47,711,926	T251A	probably benign	Het
Cdx1	A	G	18: 61,019,898	V212A	probably benign	Het
Cep95	C	T	11: 106,814,638	T483I	probably damaging	Het
Cfap100	T	C	6: 90,412,347		probably benign	Het
Cfap54	A	G	10: 92,884,702	V2630A	unknown	Het
Chia1	T	A	3: 106,128,559	N238K	probably benign	Het
Cldn23	T	A	8: 35,825,945	I130F	possibly damaging	Het
Cntrl	T	C	2: 35,162,861	M1126T	probably benign	Het
Col28a1	A	G	6: 8,176,333	F8S	probably benign	Het
Cpeb3	C	T	19: 37,054,265	R579Q	probably damaging	Het
Creld2	G	A	15: 88,820,631	W103*	probably null	Het
Dbh	A	G	2: 27,168,222	D134G	probably damaging	Het
Dcbld1	G	T	10: 52,317,035	C292F	probably damaging	Het
Dlgap5	T	C	14: 47,407,773	K304E	probably benign	Het
Dnajc2	A	G	5: 21,781,319		probably null	Het
Eps8l2	G	A	7: 141,361,852	V650M	probably damaging	Het
Erlin1	T	C	19: 44,059,065	Y139C	probably damaging	Het
Exoc3	A	G	13: 74,173,294		probably null	Het
F5	C	A	1: 164,182,917	R406S	probably damaging	Het
Fahd1	A	T	17: 24,849,648	W152R	possibly damaging	Het
Farp2	T	A	1: 93,528,702	S36T	probably benign	Het
Foxs1	A	G	2: 152,932,840	C98R	probably damaging	Het
Gal3st4	T	A	5: 138,265,410	K442N	probably benign	Het
Gm10644	G	A	8: 83,933,850		probably benign	Het
Gm8674	A	T	13: 49,900,853		noncoding transcript	Het
Gpr88	G	T	3: 116,252,424	S79R	possibly damaging	Het
Heatr9	T	G	11: 83,518,209	I171L	possibly damaging	Het
Hectd4	A	G	5: 121,322,294	T2209A	probably benign	Het
Hsh2d	A	G	8: 72,193,521	T21A	probably damaging	Het
Irf4	A	T	13: 30,761,462	Q397L	probably benign	Het
Itgae	T	A	11: 73,118,643		probably benign	Het
Jrkl	A	T	9: 13,245,604	D17E	possibly damaging	Het
Kcna4	T	C	2: 107,296,778	V619A	probably benign	Het
Kcnh6	T	A	11: 106,017,444	Y295*	probably null	Het
Kif1b	G	A	4: 149,267,216	T263I	probably damaging	Het
Large2	G	T	2: 92,365,825		probably benign	Het
Lcp1	T	A	14: 75,199,297	Y28N	possibly damaging	Het
Man1c1	G	C	4: 134,703,438	P11R	probably damaging	Het
Mccc2	T	C	13: 99,948,530		probably null	Het
Mlh3	T	C	12: 85,261,668	Y1115C	probably benign	Het
Mlst8	C	T	17: 24,477,290	W155*	probably null	Het
Myh10	T	C	11: 68,790,208	L1025P	probably damaging	Het
Myof	T	A	19: 37,977,693	N393I	probably damaging	Het
Nalcn	C	T	14: 123,302,769	V1140I	probably benign	Het
Ncald	C	T	15: 37,397,080	A119T	probably benign	Het
Nipbl	T	C	15: 8,343,630	E1044G	possibly damaging	Het
Nupl1	T	C	14: 60,238,531	K279R	probably benign	Het
Oas1a	A	T	5: 120,905,813	N85K	possibly damaging	Het
Olfr1076	A	G	2: 86,508,999	D180G	probably damaging	Het
Olfr738	C	T	14: 50,414,341	P266S	probably damaging	Het
Olfr870	T	C	9: 20,171,028	Y181C	probably benign	Het
Pou2f2	C	T	7: 25,100,156	A92T	possibly damaging	Het
Ppp1r16a	T	C	15: 76,693,068	L212P	probably damaging	Het
Pram1	A	T	17: 33,641,157	I233F	probably benign	Het
Ptbp3	A	T	4: 59,517,635	L84Q	probably damaging	Het
Ptgr2	A	T	12: 84,302,322	Q145L	probably benign	Het
Ptpn23	A	T	9: 110,386,507	D1396E	probably damaging	Het
Pudp	T	C	18: 50,568,207	N152D	probably benign	Het
Rbm20	T	A	19: 53,864,087	L1166Q	probably damaging	Het
Rictor	T	G	15: 6,759,572	I223R	probably damaging	Het
Ripor1	A	T	8: 105,616,886	E270D	probably damaging	Het
Rorc	T	C	3: 94,391,173	C322R	probably damaging	Het
Rsf1	GCG	GCGACGGCGACG	7: 97,579,907		probably benign	Het
Sptan1	C	G	2: 30,011,036	Q1425E	probably benign	Het
Srd5a3	G	A	5: 76,147,705	V81I	probably benign	Het
Stk36	T	A	1: 74,634,187	S1080T	probably benign	Het
Sugp2	T	A	8: 70,253,660	I790K	probably damaging	Het
Syde2	T	G	3: 146,014,316	Y764*	probably null	Het
Tmem130	A	G	5: 144,737,856	F353S	probably damaging	Het
Tmem131	T	A	1: 36,796,266	K1591N	probably damaging	Het
Urb2	C	A	8: 124,029,798	T748K	possibly damaging	Het
Uri1	A	T	7: 37,961,678	I480K	probably damaging	Het
Zcchc3	A	C	2: 152,413,681	V366G	probably benign	Het
Zfp292	G	A	4: 34,805,100	S2648F	possibly damaging	Het
Zfp54	T	C	17: 21,434,152	Y303H	probably benign	Het
Zfp729b	A	G	13: 67,593,220	F319L	probably damaging	Het
Zfp934	G	A	13: 62,517,955	H291Y	probably damaging	Het

Other mutations in Rpgrip1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Rpgrip1l	APN	8	91263574	missense	possibly damaging	0.52
IGL00932:Rpgrip1l	APN	8	91275637	missense	probably benign	0.33
IGL01113:Rpgrip1l	APN	8	91260739	intron	probably benign
IGL01151:Rpgrip1l	APN	8	91275149	missense	probably damaging	1.00
IGL01321:Rpgrip1l	APN	8	91260873	nonsense	probably null
IGL01384:Rpgrip1l	APN	8	91273640	missense	probably benign	0.00
IGL01634:Rpgrip1l	APN	8	91252543	missense	probably benign
IGL01634:Rpgrip1l	APN	8	91252544	missense	probably benign	0.25
IGL01781:Rpgrip1l	APN	8	91270218	missense	probably benign	0.16
IGL01784:Rpgrip1l	APN	8	91270461	missense	possibly damaging	0.56
IGL02034:Rpgrip1l	APN	8	91251148	critical splice donor site	probably null
IGL02250:Rpgrip1l	APN	8	91232861	missense	probably benign	0.00
IGL02285:Rpgrip1l	APN	8	91232907	missense	possibly damaging	0.92
IGL02634:Rpgrip1l	APN	8	91225344	splice site	probably benign
IGL02736:Rpgrip1l	APN	8	91263591	missense	possibly damaging	0.91
IGL02825:Rpgrip1l	APN	8	91304805	missense	probably damaging	0.99
IGL02962:Rpgrip1l	APN	8	91270362	missense	possibly damaging	0.95
IGL03031:Rpgrip1l	APN	8	91260783	missense	probably damaging	1.00
IGL03184:Rpgrip1l	APN	8	91300809	missense	probably damaging	1.00
P0005:Rpgrip1l	UTSW	8	91299225	splice site	probably benign
R0118:Rpgrip1l	UTSW	8	91270122	missense	probably damaging	1.00
R0490:Rpgrip1l	UTSW	8	91299845	splice site	probably benign
R0599:Rpgrip1l	UTSW	8	91305000	missense	probably damaging	1.00
R1514:Rpgrip1l	UTSW	8	91260750	missense	probably damaging	1.00
R1648:Rpgrip1l	UTSW	8	91252889	missense	probably damaging	1.00
R1914:Rpgrip1l	UTSW	8	91232924	missense	probably benign	0.13
R2093:Rpgrip1l	UTSW	8	91270132	missense	possibly damaging	0.87
R2225:Rpgrip1l	UTSW	8	91221467	missense	probably benign	0.45
R2504:Rpgrip1l	UTSW	8	91280716	critical splice donor site	probably null
R3859:Rpgrip1l	UTSW	8	91263658	missense	probably benign	0.00
R4118:Rpgrip1l	UTSW	8	91252907	missense	probably benign
R4801:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4802:Rpgrip1l	UTSW	8	91270177	missense	probably damaging	1.00
R4921:Rpgrip1l	UTSW	8	91261009	missense	probably benign	0.05
R4976:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5092:Rpgrip1l	UTSW	8	91221384	nonsense	probably null
R5099:Rpgrip1l	UTSW	8	91248722	missense	probably benign	0.20
R5119:Rpgrip1l	UTSW	8	91280816	missense	probably damaging	1.00
R5141:Rpgrip1l	UTSW	8	91260918	missense	probably benign	0.29
R5793:Rpgrip1l	UTSW	8	91260772	missense	probably benign	0.06
R5847:Rpgrip1l	UTSW	8	91304985	missense	probably damaging	1.00
R5871:Rpgrip1l	UTSW	8	91221386	missense	possibly damaging	0.89
R5916:Rpgrip1l	UTSW	8	91252913	missense	possibly damaging	0.93
R6619:Rpgrip1l	UTSW	8	91232871	missense	possibly damaging	0.69
R6654:Rpgrip1l	UTSW	8	91220205	missense	probably benign	0.36
R6984:Rpgrip1l	UTSW	8	91260798	missense	probably benign	0.03
Z1088:Rpgrip1l	UTSW	8	91220179	makesense	probably null
Z1088:Rpgrip1l	UTSW	8	91260975	missense	possibly damaging	0.96
Z1088:Rpgrip1l	UTSW	8	91270120	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CCTTAGCTTCCTTCACAGACAG -3'
(R):5'- TGTGGAATGTATGGGAGCATACAC -3'

Sequencing Primer
(F):5'- TAGCTTCCTTCACAGACAGGAAAAAC -3'
(R):5'- TATGGGAGCATACACTGTGC -3'

Posted On

2014-07-14