Incidental Mutation 'R1916:Kcnt1'
ID214830
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R1916 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25900469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 481 (V481A)
Ref Sequence ENSEMBL: ENSMUSP00000143106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037580
AA Change: V481A

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: V481A

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114172
AA Change: V467A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: V467A

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
AA Change: V481A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: V481A

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138568
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171268
AA Change: V461A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: V461A

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: V481A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: V481A

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
AA Change: V447A

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: V447A

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
AA Change: V447A

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: V447A

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Cfap69 T C 5: 5,663,970 K21E probably damaging Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock6 A T 9: 21,813,091 M301K probably damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Eps15 A G 4: 109,368,974 K324E probably damaging Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Hif3a T C 7: 17,039,656 S573G possibly damaging Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr1261 T C 2: 89,993,804 V137A probably benign Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25900892 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25877915 missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25909322 intron probably benign
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25894524 intron probably benign
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6336:Kcnt1 UTSW 2 25888755 unclassified probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
R7236:Kcnt1 UTSW 2 25909939 splice site probably null
R7308:Kcnt1 UTSW 2 25900463 missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25863843 unclassified probably benign
R7419:Kcnt1 UTSW 2 25915999 missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25901346 missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25909833 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTTTATCCTCAGCAGCAG -3'
(R):5'- TGGGACGACAGATCATTTGCC -3'

Sequencing Primer
(F):5'- GCTTTATCCTCAGCAGCAGGAATG -3'
(R):5'- AGATCATTTGCCAAGGCTGC -3'
Posted On2014-07-14