Incidental Mutation 'R1916:Eps15'
ID214846
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1916 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109368974 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 324 (K324E)
Ref Sequence ENSEMBL: ENSMUSP00000030281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030281] [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably damaging
Transcript: ENSMUST00000030281
AA Change: K324E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552
AA Change: K324E

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102729
AA Change: K638E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: K638E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126015
Predicted Effect possibly damaging
Transcript: ENSMUST00000132165
AA Change: K505E

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: K505E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175776
AA Change: K674E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: K674E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176251
AA Change: K638E

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552
AA Change: K638E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177140
Predicted Effect probably benign
Transcript: ENSMUST00000177192
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Cfap69 T C 5: 5,663,970 K21E probably damaging Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock6 A T 9: 21,813,091 M301K probably damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Hif3a T C 7: 17,039,656 S573G possibly damaging Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Kcnt1 T C 2: 25,900,469 V481A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr1261 T C 2: 89,993,804 V137A probably benign Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1799:Eps15 UTSW 4 109382837 missense probably damaging 1.00
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6885:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
R7362:Eps15 UTSW 4 109366242 critical splice donor site probably null
R7461:Eps15 UTSW 4 109329725 missense probably damaging 1.00
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCCTGTAAACTCTTTCAATCAAAG -3'
(R):5'- AGTCCTGTTTAACCCCAACACA -3'

Sequencing Primer
(F):5'- CTGTGGAGGACATTTCGATTCAAACC -3'
(R):5'- GTCCTGTTTAACCCCAACACAGATAC -3'
Posted On2014-07-14