Incidental Mutation 'R1916:Cfap69'
ID214849
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 039934-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1916 (G1)
Quality Score149
Status Validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5663970 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 21 (K21E)
Ref Sequence ENSEMBL: ENSMUSP00000122569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000061008] [ENSMUST00000115426] [ENSMUST00000115427] [ENSMUST00000132510] [ENSMUST00000135252] [ENSMUST00000148193] [ENSMUST00000164219] [ENSMUST00000196165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054865
AA Change: K21E

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061008
AA Change: K21E

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000051741
Gene: ENSMUSG00000040473
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115426
SMART Domains Protein: ENSMUSP00000111086
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115427
SMART Domains Protein: ENSMUSP00000111087
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 2.3e-17 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 401 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132510
AA Change: K21E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000135252
AA Change: K21E

PolyPhen 2 Score 0.725 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000117518
Gene: ENSMUSG00000040473
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148193
Predicted Effect probably benign
Transcript: ENSMUST00000164219
SMART Domains Protein: ENSMUSP00000132501
Gene: ENSMUSG00000015653

DomainStartEndE-ValueType
Pfam:F420_oxidored 31 118 4e-18 PFAM
transmembrane domain 209 231 N/A INTRINSIC
Pfam:Ferric_reduct 258 406 1.5e-22 PFAM
transmembrane domain 431 453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196165
AA Change: K21E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: K21E

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198121
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.5%
Validation Efficiency 99% (97/98)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,768,475 T588A probably damaging Het
Abca13 G T 11: 9,534,456 W4342L probably damaging Het
Abcg8 A T 17: 84,688,530 probably null Het
Acaa1b A G 9: 119,156,662 L65P probably damaging Het
Adam6a G T 12: 113,545,936 R643L probably benign Het
Agbl2 A T 2: 90,815,441 R839S possibly damaging Het
Ambra1 A T 2: 91,911,461 N967I probably damaging Het
Ankrd17 T A 5: 90,260,141 N1406Y probably damaging Het
Bbx G T 16: 50,266,245 S96Y probably damaging Het
Casc1 A C 6: 145,176,200 V631G probably benign Het
Cdh12 T A 15: 21,520,250 probably null Het
Cdh9 A C 15: 16,823,275 R114S probably benign Het
Cenpo T G 12: 4,216,683 I142L probably benign Het
Chmp4c A T 3: 10,389,936 D221V probably benign Het
Cstf3 T A 2: 104,655,756 V447D possibly damaging Het
Cwc22 A T 2: 77,905,475 C566S probably benign Het
Dgkh A G 14: 78,595,223 M798T probably damaging Het
Dnaic2 T C 11: 114,732,923 V4A possibly damaging Het
Dnmbp T G 19: 43,901,568 I587L possibly damaging Het
Dock6 A T 9: 21,813,091 M301K probably damaging Het
Dock8 T C 19: 25,061,157 M69T probably benign Het
Ears2 T C 7: 122,044,578 S386G probably benign Het
Ecsit T C 9: 22,072,521 I371V probably benign Het
Eif4a3 T C 11: 119,293,911 I216V probably benign Het
Emp1 A G 6: 135,380,130 I69V probably damaging Het
Epg5 A G 18: 77,965,021 D788G probably benign Het
Eps15 A G 4: 109,368,974 K324E probably damaging Het
Extl3 A G 14: 65,077,622 F37S probably benign Het
Fam83g A G 11: 61,695,168 D194G probably damaging Het
Gcc2 A G 10: 58,276,663 D1005G probably damaging Het
Gm10226 T A 17: 21,692,009 H50Q possibly damaging Het
Gm1110 A T 9: 26,889,638 V420E probably damaging Het
Gm16503 A G 4: 147,541,210 R54G unknown Het
Gm5538 A G 3: 59,745,503 K121R possibly damaging Het
Grasp T C 15: 101,226,969 probably benign Het
Grin3b T C 10: 79,974,598 M646T probably damaging Het
Grm8 T C 6: 27,363,584 D644G probably benign Het
Gtf2i C A 5: 134,246,848 V660F probably damaging Het
Heatr4 G T 12: 83,955,817 Q808K probably benign Het
Hif3a T C 7: 17,039,656 S573G possibly damaging Het
Htr2b C T 1: 86,099,801 V328M probably damaging Het
Jph1 T C 1: 17,092,055 T128A probably damaging Het
Kcnt1 T C 2: 25,900,469 V481A probably damaging Het
Khk A G 5: 30,930,618 Y212C probably damaging Het
Lgi2 T A 5: 52,546,632 Q219L probably benign Het
Lipf T A 19: 33,965,675 Y128N probably benign Het
Lipg A G 18: 74,960,937 V13A probably benign Het
Lrrc8e T C 8: 4,235,202 S476P probably benign Het
Map2k7 T G 8: 4,245,795 V425G probably benign Het
Mycbp2 A T 14: 103,184,883 S2451R probably damaging Het
Mylk3 A G 8: 85,327,192 S629P probably damaging Het
Nrp2 A T 1: 62,762,747 I450F probably damaging Het
Olfr1261 T C 2: 89,993,804 V137A probably benign Het
Olfr150 A G 9: 39,737,622 D269G probably benign Het
Osbpl11 T C 16: 33,185,843 S14P probably benign Het
Osbpl11 T A 16: 33,210,095 V231D possibly damaging Het
Parg T A 14: 32,208,227 probably benign Het
Pax9 G T 12: 56,697,138 R190L possibly damaging Het
Prss12 G A 3: 123,506,495 V752I probably benign Het
Pstpip2 A G 18: 77,835,192 N34S probably damaging Het
Rarg T C 15: 102,252,445 D53G probably benign Het
Rbak T C 5: 143,176,116 K53R probably damaging Het
Scgn A T 13: 23,978,825 S107R probably damaging Het
Sema3c A G 5: 17,727,401 Q634R probably benign Het
Serpinh1 A G 7: 99,349,081 L114P probably damaging Het
Slc35f4 T C 14: 49,303,923 probably benign Het
Sned1 A T 1: 93,274,162 I617F probably null Het
Spata31 C T 13: 64,922,545 R836* probably null Het
Spen A G 4: 141,472,598 L2883P probably damaging Het
Stmn3 A T 2: 181,307,280 M140K possibly damaging Het
Syn3 A G 10: 86,354,344 probably null Het
Tor4a A G 2: 25,195,402 V163A possibly damaging Het
Ttc12 A G 9: 49,460,398 Y189H probably damaging Het
Ubxn7 T G 16: 32,381,759 probably benign Het
Unc5b G A 10: 60,778,248 T274I probably damaging Het
Upk1b C A 16: 38,776,186 probably null Het
Usp18 A G 6: 121,268,554 I296M probably benign Het
Usp42 A G 5: 143,715,056 Y1071H probably damaging Het
Vil1 A G 1: 74,418,525 T106A probably benign Het
Vmn1r42 T A 6: 89,844,967 I207F probably benign Het
Vmn1r63 A G 7: 5,803,226 F136L probably damaging Het
Vopp1 C T 6: 57,754,587 V140I probably benign Het
Wdhd1 T C 14: 47,258,577 D610G possibly damaging Het
Wdr48 T A 9: 119,912,417 D142E probably benign Het
Whrn A G 4: 63,494,732 Y10H probably damaging Het
Zmat3 A G 3: 32,343,348 V216A probably benign Het
Zmym2 C T 14: 56,959,842 R1356W probably damaging Het
Zyg11b A T 4: 108,272,283 L44Q probably damaging Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1857:Cfap69 UTSW 5 5582518 missense possibly damaging 0.92
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Predicted Primers PCR Primer
(F):5'- GACAGATTGGTTGACGACATCC -3'
(R):5'- AGAACTTTCGGGGTCTTTCTCC -3'

Sequencing Primer
(F):5'- AGATTGGTTGACGACATCCAGTCC -3'
(R):5'- TCCTCCCTAGCTCAGCAG -3'
Posted On2014-07-14