Incidental Mutation 'R1927:Stmn2'
ID214929
Institutional Source Beutler Lab
Gene Symbol Stmn2
Ensembl Gene ENSMUSG00000027500
Gene Namestathmin-like 2
SynonymsScgn10, SCG10
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.562) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location8509360-8561606 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8545576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 40 (M40K)
Ref Sequence ENSEMBL: ENSMUSP00000029002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029002]
Predicted Effect probably benign
Transcript: ENSMUST00000029002
AA Change: M40K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000029002
Gene: ENSMUSG00000027500
AA Change: M40K

DomainStartEndE-ValueType
Pfam:Stathmin 41 174 3.7e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194905
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Stmn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Stmn2 APN 3 8560261 splice site probably benign
R0362:Stmn2 UTSW 3 8545690 missense probably damaging 0.99
R1885:Stmn2 UTSW 3 8541904 missense probably damaging 1.00
R2261:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2262:Stmn2 UTSW 3 8541895 missense probably damaging 0.97
R2901:Stmn2 UTSW 3 8541921 missense probably benign
R4066:Stmn2 UTSW 3 8509608 utr 5 prime probably benign
R4938:Stmn2 UTSW 3 8545732 missense probably damaging 1.00
R5191:Stmn2 UTSW 3 8545575 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAACATTTTGTACAATGAGCACATTC -3'
(R):5'- CCCCTGGAGAAAGTTACCTTT -3'

Sequencing Primer
(F):5'- TACACTCTGCTCTATGAGGACAGG -3'
(R):5'- AAAGTTACCTTTCTTCGCTCCTCTG -3'
Posted On2014-07-14