Incidental Mutation 'R1927:Olfr1463'
ID214999
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13235029 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 260 (Y260H)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect probably damaging
Transcript: ENSMUST00000064102
AA Change: Y260H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: Y260H

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207246
AA Change: Y260H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0652:Olfr1463 UTSW 19 13234535 missense possibly damaging 0.80
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGGATAGGCATATCAATGAGCTAGTAC -3'
(R):5'- GGCAAGAATAAGAACTCACATCATG -3'

Sequencing Primer
(F):5'- AGCTAGTACTTATTTATCTAGCCAGC -3'
(R):5'- TTAATATTATGGAGAATGCCAGGGCC -3'
Posted On2014-07-14