Incidental Mutation 'R1928:Rsf1'
ID215054
Institutional Source Beutler Lab
Gene Symbol Rsf1
Ensembl Gene ENSMUSG00000035623
Gene Nameremodeling and spacing factor 1
Synonymsp325, Hbxap, C030033M12Rik, 4832420A03Rik, XAP8
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1928 (G1)
Quality Score214
Status Not validated
Chromosome7
Chromosomal Location97579889-97692778 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to GACGGCGGCT at 97579909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042627] [ENSMUST00000072725] [ENSMUST00000107153] [ENSMUST00000124552] [ENSMUST00000126085] [ENSMUST00000127891] [ENSMUST00000135998] [ENSMUST00000136757] [ENSMUST00000138060] [ENSMUST00000144858] [ENSMUST00000146605] [ENSMUST00000151840] [ENSMUST00000154779] [ENSMUST00000154853] [ENSMUST00000178078]
Predicted Effect unknown
Transcript: ENSMUST00000042399
SMART Domains Protein: ENSMUSP00000037409
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 40 53 N/A INTRINSIC
Pfam:WHIM1 103 153 9.3e-11 PFAM
Pfam:WHIM2 155 187 7.2e-10 PFAM
low complexity region 236 246 N/A INTRINSIC
low complexity region 299 311 N/A INTRINSIC
low complexity region 758 773 N/A INTRINSIC
low complexity region 860 874 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
PHD 896 942 1.57e-11 SMART
low complexity region 960 974 N/A INTRINSIC
low complexity region 986 1008 N/A INTRINSIC
low complexity region 1026 1045 N/A INTRINSIC
low complexity region 1087 1111 N/A INTRINSIC
low complexity region 1125 1143 N/A INTRINSIC
low complexity region 1148 1167 N/A INTRINSIC
low complexity region 1175 1205 N/A INTRINSIC
low complexity region 1207 1213 N/A INTRINSIC
low complexity region 1249 1263 N/A INTRINSIC
low complexity region 1283 1295 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042627
SMART Domains Protein: ENSMUSP00000035883
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072725
SMART Domains Protein: ENSMUSP00000072508
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 68 115 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107153
SMART Domains Protein: ENSMUSP00000102771
Gene: ENSMUSG00000035623

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:WHIM1 88 138 2.2e-10 PFAM
Pfam:WHIM2 140 172 9.4e-8 PFAM
Pfam:WHIM3 178 398 2.5e-27 PFAM
low complexity region 743 758 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 863 872 N/A INTRINSIC
PHD 881 927 1.57e-11 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 971 993 N/A INTRINSIC
low complexity region 1011 1030 N/A INTRINSIC
low complexity region 1072 1096 N/A INTRINSIC
low complexity region 1110 1128 N/A INTRINSIC
low complexity region 1133 1152 N/A INTRINSIC
low complexity region 1160 1190 N/A INTRINSIC
low complexity region 1192 1198 N/A INTRINSIC
low complexity region 1234 1248 N/A INTRINSIC
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124552
SMART Domains Protein: ENSMUSP00000120661
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 2 49 8.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126085
SMART Domains Protein: ENSMUSP00000120089
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
SCOP:d1uroa_ 21 60 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127891
Predicted Effect probably benign
Transcript: ENSMUST00000135998
SMART Domains Protein: ENSMUSP00000118391
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 128 4.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136757
SMART Domains Protein: ENSMUSP00000121940
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 6 119 2.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138060
SMART Domains Protein: ENSMUSP00000116214
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 40 87 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140805
Predicted Effect probably benign
Transcript: ENSMUST00000144858
SMART Domains Protein: ENSMUSP00000117205
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 11 65 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146605
SMART Domains Protein: ENSMUSP00000117571
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
Pfam:DUF498 23 136 3.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151840
SMART Domains Protein: ENSMUSP00000115852
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:2Q4Q|B 31 75 5e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154779
SMART Domains Protein: ENSMUSP00000120195
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
transmembrane domain 30 49 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154853
SMART Domains Protein: ENSMUSP00000115672
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156060
Predicted Effect probably benign
Transcript: ENSMUST00000178078
SMART Domains Protein: ENSMUSP00000137067
Gene: ENSMUSG00000035642

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF498 34 147 2.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205536
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that interacts with hepatitis B virus X protein (HBX) and facilitates transcription of hepatitis B virus genes by the HBX transcription activator, suggesting a role for this interaction in the virus life cycle. This protein also interacts with SNF2H protein to form the RSF chromatin-remodeling complex, where the SNF2H subunit functions as the nucleosome-dependent ATPase, and this protein as the histone chaperone. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Rsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Rsf1 APN 7 97681889 critical splice donor site probably null 0.00
IGL01160:Rsf1 APN 7 97685584 missense probably damaging 1.00
IGL01780:Rsf1 APN 7 97664770 critical splice donor site probably benign 0.00
IGL01960:Rsf1 APN 7 97661575 missense probably benign 0.00
IGL02487:Rsf1 APN 7 97639491 missense probably damaging 0.99
IGL02814:Rsf1 APN 7 97661227 missense probably damaging 1.00
IGL02972:Rsf1 APN 7 97661326 missense probably benign 0.35
IGL03176:Rsf1 APN 7 97679150 splice site probably benign
IGL03256:Rsf1 APN 7 97679004 missense possibly damaging 0.82
FR4976:Rsf1 UTSW 7 97579909 unclassified probably benign
P0023:Rsf1 UTSW 7 97662271 missense probably damaging 1.00
R0144:Rsf1 UTSW 7 97636407 missense probably damaging 1.00
R0380:Rsf1 UTSW 7 97579905 unclassified probably benign
R0392:Rsf1 UTSW 7 97679005 missense probably benign 0.00
R0422:Rsf1 UTSW 7 97680817 missense probably benign 0.04
R0584:Rsf1 UTSW 7 97662128 missense possibly damaging 0.60
R0636:Rsf1 UTSW 7 97662019 missense possibly damaging 0.74
R0729:Rsf1 UTSW 7 97679027 missense probably damaging 1.00
R0755:Rsf1 UTSW 7 97579967 missense probably damaging 1.00
R0947:Rsf1 UTSW 7 97669778 missense probably damaging 1.00
R1278:Rsf1 UTSW 7 97579904 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1376:Rsf1 UTSW 7 97579907 unclassified probably benign
R1498:Rsf1 UTSW 7 97579907 unclassified probably benign
R1525:Rsf1 UTSW 7 97579908 unclassified probably benign
R1534:Rsf1 UTSW 7 97579909 unclassified probably benign
R1582:Rsf1 UTSW 7 97579908 unclassified probably benign
R1591:Rsf1 UTSW 7 97639313 nonsense probably null
R1676:Rsf1 UTSW 7 97579904 unclassified probably benign
R1695:Rsf1 UTSW 7 97579907 unclassified probably benign
R1710:Rsf1 UTSW 7 97662349 missense possibly damaging 0.50
R1722:Rsf1 UTSW 7 97579908 unclassified probably benign
R1764:Rsf1 UTSW 7 97579908 unclassified probably benign
R1815:Rsf1 UTSW 7 97579906 unclassified probably benign
R1815:Rsf1 UTSW 7 97579907 unclassified probably benign
R1815:Rsf1 UTSW 7 97579908 unclassified probably benign
R1823:Rsf1 UTSW 7 97579910 unclassified probably benign
R1864:Rsf1 UTSW 7 97579904 unclassified probably benign
R1884:Rsf1 UTSW 7 97579910 unclassified probably benign
R1897:Rsf1 UTSW 7 97579910 unclassified probably benign
R1915:Rsf1 UTSW 7 97579907 unclassified probably benign
R1958:Rsf1 UTSW 7 97579908 unclassified probably benign
R1962:Rsf1 UTSW 7 97579906 unclassified probably benign
R1962:Rsf1 UTSW 7 97579907 unclassified probably benign
R1996:Rsf1 UTSW 7 97664632 missense probably damaging 1.00
R1999:Rsf1 UTSW 7 97579908 unclassified probably benign
R2021:Rsf1 UTSW 7 97579906 unclassified probably benign
R2022:Rsf1 UTSW 7 97579910 unclassified probably benign
R2046:Rsf1 UTSW 7 97661677 missense probably benign 0.00
R2048:Rsf1 UTSW 7 97579907 unclassified probably benign
R2093:Rsf1 UTSW 7 97579908 unclassified probably benign
R2103:Rsf1 UTSW 7 97579906 unclassified probably benign
R2137:Rsf1 UTSW 7 97579904 unclassified probably benign
R2167:Rsf1 UTSW 7 97579906 unclassified probably benign
R2179:Rsf1 UTSW 7 97579909 unclassified probably benign
R2191:Rsf1 UTSW 7 97579907 unclassified probably benign
R2207:Rsf1 UTSW 7 97579907 unclassified probably benign
R2211:Rsf1 UTSW 7 97579904 unclassified probably benign
R2241:Rsf1 UTSW 7 97579904 unclassified probably benign
R2264:Rsf1 UTSW 7 97579908 unclassified probably benign
R2283:Rsf1 UTSW 7 97579909 unclassified probably benign
R2297:Rsf1 UTSW 7 97579904 unclassified probably benign
R2307:Rsf1 UTSW 7 97579908 unclassified probably benign
R2419:Rsf1 UTSW 7 97579908 unclassified probably benign
R2442:Rsf1 UTSW 7 97579908 unclassified probably benign
R2696:Rsf1 UTSW 7 97579933 unclassified probably benign
R2764:Rsf1 UTSW 7 97579904 unclassified probably benign
R2939:Rsf1 UTSW 7 97579908 unclassified probably benign
R2965:Rsf1 UTSW 7 97579908 unclassified probably benign
R2972:Rsf1 UTSW 7 97579904 unclassified probably benign
R3008:Rsf1 UTSW 7 97579904 unclassified probably benign
R3013:Rsf1 UTSW 7 97579904 unclassified probably benign
R3026:Rsf1 UTSW 7 97579909 unclassified probably benign
R3110:Rsf1 UTSW 7 97579904 unclassified probably benign
R3147:Rsf1 UTSW 7 97579908 unclassified probably benign
R3427:Rsf1 UTSW 7 97579907 unclassified probably benign
R3610:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R3624:Rsf1 UTSW 7 97579904 unclassified probably benign
R3753:Rsf1 UTSW 7 97662152 missense probably benign 0.00
R3759:Rsf1 UTSW 7 97579909 unclassified probably benign
R3780:Rsf1 UTSW 7 97579904 unclassified probably benign
R3794:Rsf1 UTSW 7 97579904 unclassified probably benign
R3889:Rsf1 UTSW 7 97579906 unclassified probably benign
R3925:Rsf1 UTSW 7 97579907 unclassified probably benign
R3964:Rsf1 UTSW 7 97579907 unclassified probably benign
R4037:Rsf1 UTSW 7 97579904 unclassified probably benign
R4057:Rsf1 UTSW 7 97579906 unclassified probably benign
R4057:Rsf1 UTSW 7 97579907 unclassified probably benign
R4084:Rsf1 UTSW 7 97579919 unclassified probably benign
R4240:Rsf1 UTSW 7 97579935 unclassified probably benign
R4303:Rsf1 UTSW 7 97579920 unclassified probably benign
R4383:Rsf1 UTSW 7 97685476 missense possibly damaging 0.86
R4492:Rsf1 UTSW 7 97579923 unclassified probably benign
R4525:Rsf1 UTSW 7 97579926 unclassified probably benign
R4530:Rsf1 UTSW 7 97579923 unclassified probably benign
R4543:Rsf1 UTSW 7 97579922 unclassified probably benign
R4629:Rsf1 UTSW 7 97579906 unclassified probably benign
R4629:Rsf1 UTSW 7 97579908 unclassified probably benign
R4632:Rsf1 UTSW 7 97579904 unclassified probably benign
R4633:Rsf1 UTSW 7 97579907 unclassified probably benign
R4652:Rsf1 UTSW 7 97579919 unclassified probably benign
R4675:Rsf1 UTSW 7 97579910 unclassified probably benign
R4675:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R4677:Rsf1 UTSW 7 97680773 missense possibly damaging 0.82
R4678:Rsf1 UTSW 7 97579906 unclassified probably benign
R4769:Rsf1 UTSW 7 97676222 missense probably damaging 1.00
R4774:Rsf1 UTSW 7 97579916 unclassified probably benign
R4820:Rsf1 UTSW 7 97579919 unclassified probably benign
R4917:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4918:Rsf1 UTSW 7 97662405 missense probably damaging 1.00
R4977:Rsf1 UTSW 7 97579916 unclassified probably benign
R4979:Rsf1 UTSW 7 97579907 unclassified probably benign
R4994:Rsf1 UTSW 7 97579909 unclassified probably benign
R4994:Rsf1 UTSW 7 97579923 unclassified probably benign
R5041:Rsf1 UTSW 7 97579925 unclassified probably benign
R5125:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5178:Rsf1 UTSW 7 97661872 missense possibly damaging 0.87
R5306:Rsf1 UTSW 7 97579929 unclassified probably benign
R5369:Rsf1 UTSW 7 97579904 unclassified probably benign
R5371:Rsf1 UTSW 7 97579913 unclassified probably benign
R5403:Rsf1 UTSW 7 97579907 unclassified probably benign
R5436:Rsf1 UTSW 7 97579931 unclassified probably benign
R5450:Rsf1 UTSW 7 97579908 unclassified probably benign
R5532:Rsf1 UTSW 7 97680695 missense probably damaging 1.00
R5587:Rsf1 UTSW 7 97662121 missense probably benign 0.02
R5657:Rsf1 UTSW 7 97579934 unclassified probably benign
R5689:Rsf1 UTSW 7 97579934 unclassified probably benign
R5745:Rsf1 UTSW 7 97579920 unclassified probably benign
R5748:Rsf1 UTSW 7 97579928 unclassified probably benign
R5773:Rsf1 UTSW 7 97579933 unclassified probably benign
R5859:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R5938:Rsf1 UTSW 7 97685559 missense probably damaging 1.00
R6001:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6001:Rsf1 UTSW 7 97579907 unclassified probably benign
R6001:Rsf1 UTSW 7 97579910 unclassified probably benign
R6021:Rsf1 UTSW 7 97579909 unclassified probably benign
R6025:Rsf1 UTSW 7 97579908 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6030:Rsf1 UTSW 7 97579906 unclassified probably benign
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97662109 missense probably benign 0.01
R6035:Rsf1 UTSW 7 97579904 unclassified probably benign
R6036:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6037:Rsf1 UTSW 7 97579909 unclassified probably benign
R6073:Rsf1 UTSW 7 97579906 unclassified probably benign
R6077:Rsf1 UTSW 7 97579928 unclassified probably benign
R6102:Rsf1 UTSW 7 97579904 unclassified probably benign
R6111:Rsf1 UTSW 7 97579907 unclassified probably benign
R6126:Rsf1 UTSW 7 97579904 unclassified probably benign
R6128:Rsf1 UTSW 7 97579904 unclassified probably benign
R6130:Rsf1 UTSW 7 97579910 unclassified probably benign
R6154:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6154:Rsf1 UTSW 7 97579907 unclassified probably benign
R6165:Rsf1 UTSW 7 97579904 unclassified probably benign
R6166:Rsf1 UTSW 7 97579907 unclassified probably benign
R6182:Rsf1 UTSW 7 97579910 unclassified probably benign
R6189:Rsf1 UTSW 7 97579906 unclassified probably benign
R6200:Rsf1 UTSW 7 97579925 unclassified probably benign
R6210:Rsf1 UTSW 7 97579904 unclassified probably benign
R6212:Rsf1 UTSW 7 97579909 unclassified probably benign
R6214:Rsf1 UTSW 7 97579909 unclassified probably benign
R6215:Rsf1 UTSW 7 97579908 unclassified probably benign
R6216:Rsf1 UTSW 7 97579908 unclassified probably benign
R6232:Rsf1 UTSW 7 97579904 unclassified probably benign
R6235:Rsf1 UTSW 7 97579909 unclassified probably benign
R6242:Rsf1 UTSW 7 97579904 unclassified probably benign
R6243:Rsf1 UTSW 7 97579904 unclassified probably benign
R6244:Rsf1 UTSW 7 97579908 unclassified probably benign
R6268:Rsf1 UTSW 7 97579908 unclassified probably benign
R6269:Rsf1 UTSW 7 97579906 unclassified probably benign
R6273:Rsf1 UTSW 7 97579908 unclassified probably benign
R6275:Rsf1 UTSW 7 97579923 unclassified probably benign
R6286:Rsf1 UTSW 7 97579909 unclassified probably benign
R6291:Rsf1 UTSW 7 97579910 unclassified probably benign
R6293:Rsf1 UTSW 7 97579906 unclassified probably benign
R6297:Rsf1 UTSW 7 97579907 unclassified probably benign
R6302:Rsf1 UTSW 7 97579908 unclassified probably benign
R6309:Rsf1 UTSW 7 97579909 unclassified probably benign
R6312:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6324:Rsf1 UTSW 7 97579908 unclassified probably benign
R6343:Rsf1 UTSW 7 97660917 missense probably benign 0.30
R6346:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6356:Rsf1 UTSW 7 97661934 missense probably benign
R6370:Rsf1 UTSW 7 97579907 unclassified probably benign
R6377:Rsf1 UTSW 7 97579904 unclassified probably benign
R6377:Rsf1 UTSW 7 97579908 unclassified probably benign
R6378:Rsf1 UTSW 7 97579908 unclassified probably benign
R6394:Rsf1 UTSW 7 97579904 unclassified probably benign
R6398:Rsf1 UTSW 7 97579907 unclassified probably benign
R6406:Rsf1 UTSW 7 97579926 unclassified probably benign
R6413:Rsf1 UTSW 7 97579910 unclassified probably benign
R6443:Rsf1 UTSW 7 97579909 unclassified probably benign
R6453:Rsf1 UTSW 7 97579917 unclassified probably benign
R6471:Rsf1 UTSW 7 97579914 unclassified probably benign
R6473:Rsf1 UTSW 7 97579908 unclassified probably benign
R6497:Rsf1 UTSW 7 97579909 unclassified probably benign
R6505:Rsf1 UTSW 7 97579910 unclassified probably benign
R6561:Rsf1 UTSW 7 97579908 unclassified probably benign
R6572:Rsf1 UTSW 7 97579908 unclassified probably benign
R6607:Rsf1 UTSW 7 97579908 unclassified probably benign
R6611:Rsf1 UTSW 7 97579909 unclassified probably benign
R6622:Rsf1 UTSW 7 97579910 unclassified probably benign
R6626:Rsf1 UTSW 7 97579908 unclassified probably benign
R6636:Rsf1 UTSW 7 97579909 unclassified probably benign
R6647:Rsf1 UTSW 7 97579910 unclassified probably benign
R6648:Rsf1 UTSW 7 97579906 unclassified probably benign
R6669:Rsf1 UTSW 7 97579925 unclassified probably benign
R6673:Rsf1 UTSW 7 97579918 unclassified probably benign
R6679:Rsf1 UTSW 7 97579904 start codon destroyed probably null
R6685:Rsf1 UTSW 7 97579908 unclassified probably benign
R6694:Rsf1 UTSW 7 97579904 unclassified probably benign
R6694:Rsf1 UTSW 7 97579928 unclassified probably benign
R6695:Rsf1 UTSW 7 97579908 unclassified probably benign
R6697:Rsf1 UTSW 7 97579904 unclassified probably benign
R6726:Rsf1 UTSW 7 97579910 unclassified probably benign
R6739:Rsf1 UTSW 7 97579909 unclassified probably benign
R6747:Rsf1 UTSW 7 97579906 unclassified probably benign
R6751:Rsf1 UTSW 7 97579909 unclassified probably benign
R6771:Rsf1 UTSW 7 97579906 unclassified probably benign
R6773:Rsf1 UTSW 7 97579907 unclassified probably benign
R6787:Rsf1 UTSW 7 97579906 unclassified probably benign
R6800:Rsf1 UTSW 7 97579932 unclassified probably benign
R6804:Rsf1 UTSW 7 97579904 unclassified probably benign
R6806:Rsf1 UTSW 7 97579904 unclassified probably benign
R6815:Rsf1 UTSW 7 97579904 unclassified probably benign
R6820:Rsf1 UTSW 7 97579904 unclassified probably benign
R6823:Rsf1 UTSW 7 97579906 unclassified probably benign
R6829:Rsf1 UTSW 7 97579908 unclassified probably benign
R6861:Rsf1 UTSW 7 97579909 unclassified probably benign
R6862:Rsf1 UTSW 7 97579908 unclassified probably benign
R6869:Rsf1 UTSW 7 97579906 unclassified probably benign
R6875:Rsf1 UTSW 7 97579908 unclassified probably benign
R6889:Rsf1 UTSW 7 97579925 unclassified probably benign
R6897:Rsf1 UTSW 7 97579906 unclassified probably benign
R6960:Rsf1 UTSW 7 97579909 unclassified probably benign
R6963:Rsf1 UTSW 7 97579910 unclassified probably benign
R6967:Rsf1 UTSW 7 97579909 unclassified probably benign
R6969:Rsf1 UTSW 7 97579904 unclassified probably benign
R6977:Rsf1 UTSW 7 97579906 unclassified probably benign
R6996:Rsf1 UTSW 7 97579911 unclassified probably benign
R7066:Rsf1 UTSW 7 97579918 unclassified probably benign
R7109:Rsf1 UTSW 7 97579908 unclassified probably benign
R7127:Rsf1 UTSW 7 97579914 unclassified probably benign
R7138:Rsf1 UTSW 7 97669795 missense
R7214:Rsf1 UTSW 7 97579929 unclassified probably benign
R7217:Rsf1 UTSW 7 97579932 unclassified probably benign
R7238:Rsf1 UTSW 7 97579921 unclassified probably benign
R7246:Rsf1 UTSW 7 97579922 unclassified probably benign
R7253:Rsf1 UTSW 7 97579915 unclassified probably benign
R7294:Rsf1 UTSW 7 97579920 unclassified probably benign
R7305:Rsf1 UTSW 7 97579918 unclassified probably benign
R7309:Rsf1 UTSW 7 97579911 unclassified probably benign
R7352:Rsf1 UTSW 7 97579926 unclassified probably benign
R7380:Rsf1 UTSW 7 97579915 unclassified probably benign
R7393:Rsf1 UTSW 7 97579917 unclassified probably benign
R7395:Rsf1 UTSW 7 97579926 unclassified probably benign
R7411:Rsf1 UTSW 7 97579932 unclassified probably benign
R7413:Rsf1 UTSW 7 97579921 unclassified probably benign
R7481:Rsf1 UTSW 7 97579917 unclassified probably benign
X0025:Rsf1 UTSW 7 97636444 missense probably damaging 1.00
X0028:Rsf1 UTSW 7 97660824 nonsense probably null
Y4335:Rsf1 UTSW 7 97579904 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCGATCTAACTCAGTTCTCGAC -3'
(R):5'- CAGGGTATCTATGGAGAGCTAAAGC -3'

Sequencing Primer
(F):5'- AGTTCTCGACTGCTCCGG -3'
(R):5'- TTCGGGCCGATCGCTTAC -3'
Posted On2014-07-14