Incidental Mutation 'R0128:Gm4787'
ID21522
Institutional Source Beutler Lab
Gene Symbol Gm4787
Ensembl Gene ENSMUSG00000072974
Gene Namepredicted gene 4787
Synonyms
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0128 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location81376991-81379464 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 81377747 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 546 (K546*)
Ref Sequence ENSEMBL: ENSMUSP00000077390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062182] [ENSMUST00000110340] [ENSMUST00000164386] [ENSMUST00000166723]
Predicted Effect probably null
Transcript: ENSMUST00000062182
AA Change: K546*
SMART Domains Protein: ENSMUSP00000077390
Gene: ENSMUSG00000072974
AA Change: K546*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Pep_M12B_propep 46 163 1.5e-19 PFAM
Pfam:Reprolysin 213 406 4.6e-18 PFAM
DISIN 425 500 2e-33 SMART
ACR 501 644 2.83e-53 SMART
transmembrane domain 714 736 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000087222
Predicted Effect probably benign
Transcript: ENSMUST00000110340
SMART Domains Protein: ENSMUSP00000105969
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 74 6.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164386
SMART Domains Protein: ENSMUSP00000132941
Gene: ENSMUSG00000021139

DomainStartEndE-ValueType
PDZ 21 100 6.16e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166723
SMART Domains Protein: ENSMUSP00000130935
Gene: ENSMUSG00000091803

DomainStartEndE-ValueType
Pfam:COX16 16 73 6.9e-16 PFAM
Meta Mutation Damage Score 0.6528 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k4 T A 17: 12,248,063 D1104V probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Gm4787
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Gm4787 APN 12 81377174 missense possibly damaging 0.50
IGL01916:Gm4787 APN 12 81377444 missense probably benign 0.36
IGL02193:Gm4787 APN 12 81378528 missense probably benign 0.02
IGL02623:Gm4787 APN 12 81378728 missense probably damaging 1.00
IGL02681:Gm4787 APN 12 81378769 missense possibly damaging 0.88
IGL03257:Gm4787 APN 12 81378052 missense probably damaging 1.00
IGL03410:Gm4787 APN 12 81379174 missense probably damaging 1.00
F5770:Gm4787 UTSW 12 81377567 nonsense probably null
PIT4362001:Gm4787 UTSW 12 81377175 missense probably benign
R0070:Gm4787 UTSW 12 81379066 missense probably damaging 1.00
R0220:Gm4787 UTSW 12 81378648 missense probably damaging 0.98
R0304:Gm4787 UTSW 12 81378934 missense probably damaging 1.00
R0513:Gm4787 UTSW 12 81378312 missense probably benign 0.03
R1761:Gm4787 UTSW 12 81377176 missense probably benign 0.02
R1809:Gm4787 UTSW 12 81378529 missense possibly damaging 0.91
R1853:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R1854:Gm4787 UTSW 12 81378334 missense probably damaging 1.00
R2030:Gm4787 UTSW 12 81378770 missense probably damaging 1.00
R2063:Gm4787 UTSW 12 81378920 missense probably benign 0.39
R2112:Gm4787 UTSW 12 81377833 missense probably damaging 1.00
R2140:Gm4787 UTSW 12 81378562 missense probably benign 0.03
R2151:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2152:Gm4787 UTSW 12 81377219 missense probably benign 0.00
R2342:Gm4787 UTSW 12 81378758 missense possibly damaging 0.91
R2504:Gm4787 UTSW 12 81379137 missense possibly damaging 0.93
R4038:Gm4787 UTSW 12 81378358 missense probably damaging 1.00
R4604:Gm4787 UTSW 12 81379213 missense probably benign 0.17
R4748:Gm4787 UTSW 12 81378056 missense probably damaging 1.00
R4750:Gm4787 UTSW 12 81378367 missense possibly damaging 0.95
R4928:Gm4787 UTSW 12 81378838 missense probably benign 0.03
R4960:Gm4787 UTSW 12 81379316 missense probably damaging 0.99
R4974:Gm4787 UTSW 12 81377629 missense probably damaging 0.99
R5028:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5029:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5031:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5098:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5099:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5100:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5101:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5135:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5152:Gm4787 UTSW 12 81378677 missense probably benign 0.02
R5180:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5220:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5257:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5258:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5297:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5324:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5325:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5355:Gm4787 UTSW 12 81377465 nonsense probably null
R5364:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5396:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5397:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5398:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5514:Gm4787 UTSW 12 81378328 missense possibly damaging 0.90
R5634:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5666:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5670:Gm4787 UTSW 12 81378031 missense probably benign 0.23
R5787:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R5788:Gm4787 UTSW 12 81377830 missense probably benign 0.01
R6354:Gm4787 UTSW 12 81377981 missense probably damaging 1.00
R6932:Gm4787 UTSW 12 81379200 missense probably benign 0.04
R7120:Gm4787 UTSW 12 81378486 missense probably benign 0.00
R7237:Gm4787 UTSW 12 81377668 missense probably damaging 0.99
V7580:Gm4787 UTSW 12 81377567 nonsense probably null
V7581:Gm4787 UTSW 12 81377567 nonsense probably null
V7582:Gm4787 UTSW 12 81377567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGGTTGTTACACACCCCTCTGAAG -3'
(R):5'- GTTTGCACCCACTGGAACAATATGC -3'

Sequencing Primer
(F):5'- AGTATTTTCCAGGGCCACAAG -3'
(R):5'- CACTGGAACAATATGCAGAGAC -3'
Posted On2013-04-11