Incidental Mutation 'R1930:1700015F17Rik'
ID215257
Institutional Source Beutler Lab
Gene Symbol 1700015F17Rik
Ensembl Gene ENSMUSG00000079666
Gene NameRIKEN cDNA 1700015F17 gene
SynonymsLOC381716
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R1930 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5437827-5479143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5452019 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 144 (W144C)
Ref Sequence ENSEMBL: ENSMUSP00000111107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115447] [ENSMUST00000128151] [ENSMUST00000156282]
Predicted Effect probably benign
Transcript: ENSMUST00000115447
AA Change: W144C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111107
Gene: ENSMUSG00000079666
AA Change: W144C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128151
AA Change: G48V
Predicted Effect probably benign
Transcript: ENSMUST00000156282
SMART Domains Protein: ENSMUSP00000122651
Gene: ENSMUSG00000079666

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Meta Mutation Damage Score 0.1184 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Cep152 A T 2: 125,618,371 probably null Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hsd17b2 T C 8: 117,758,904 Y369H possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mc2r T A 18: 68,407,782 T147S probably benign Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in 1700015F17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02125:1700015F17Rik APN 5 5450644 makesense probably null
IGL02701:1700015F17Rik APN 5 5466623 critical splice donor site probably null
IGL02821:1700015F17Rik APN 5 5452039 nonsense probably null
R1029:1700015F17Rik UTSW 5 5455919 missense probably benign 0.21
R1463:1700015F17Rik UTSW 5 5452073 splice site probably benign
R1525:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1550:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1764:1700015F17Rik UTSW 5 5478943 missense possibly damaging 0.83
R1911:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1912:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R1931:1700015F17Rik UTSW 5 5452019 missense probably benign 0.00
R2013:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2014:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2015:1700015F17Rik UTSW 5 5455964 missense probably benign 0.00
R2151:1700015F17Rik UTSW 5 5478875 missense possibly damaging 0.46
R2420:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R2421:1700015F17Rik UTSW 5 5455912 missense probably benign 0.00
R3056:1700015F17Rik UTSW 5 5457283 critical splice donor site probably null
R4012:1700015F17Rik UTSW 5 5478955 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTAATAACCCACTCCAATGTTCC -3'
(R):5'- ACTCTCCTGATGAGTAGATGAAAG -3'

Sequencing Primer
(F):5'- GCAAATCCCAGTCTAACTATTAAGG -3'
(R):5'- CTCCTGATGAGTAGATGAAAGAATTC -3'
Posted On2014-07-14