Incidental Mutation 'R1931:Polr2a'
ID215381
Institutional Source Beutler Lab
Gene Symbol Polr2a
Ensembl Gene ENSMUSG00000005198
Gene Namepolymerase (RNA) II (DNA directed) polypeptide A
SynonymsRpo2-1, 220kDa
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.991) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69733997-69758637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69735375 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1612 (Y1612N)
Ref Sequence ENSEMBL: ENSMUSP00000071200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]
Predicted Effect unknown
Transcript: ENSMUST00000058470
AA Change: Y1650N
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: Y1650N

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000071213
AA Change: Y1612N
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: Y1612N

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156588
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Polr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Polr2a APN 11 69743794 splice site probably benign
IGL01067:Polr2a APN 11 69748014 missense possibly damaging 0.94
IGL01547:Polr2a APN 11 69744942 missense probably damaging 0.99
IGL01589:Polr2a APN 11 69741194 missense probably benign
IGL01955:Polr2a APN 11 69741848 missense probably damaging 1.00
IGL02457:Polr2a APN 11 69743250 splice site probably benign
IGL02526:Polr2a APN 11 69739467 missense probably benign 0.03
IGL02792:Polr2a APN 11 69746112 missense probably damaging 0.99
IGL03058:Polr2a APN 11 69745047 splice site probably null
IGL03083:Polr2a APN 11 69745046 critical splice acceptor site probably null
IGL03198:Polr2a APN 11 69747281 splice site probably null
IGL03201:Polr2a APN 11 69745690 nonsense probably null
PIT4260001:Polr2a UTSW 11 69735967 missense possibly damaging 0.93
R0126:Polr2a UTSW 11 69747425 missense probably damaging 0.99
R0254:Polr2a UTSW 11 69743671 missense possibly damaging 0.75
R0313:Polr2a UTSW 11 69735080 missense unknown
R0336:Polr2a UTSW 11 69736893 missense possibly damaging 0.92
R0453:Polr2a UTSW 11 69741019 missense possibly damaging 0.65
R0762:Polr2a UTSW 11 69735117 missense unknown
R1101:Polr2a UTSW 11 69748071 missense probably benign 0.23
R1509:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R1547:Polr2a UTSW 11 69734555 missense probably benign 0.39
R1567:Polr2a UTSW 11 69746031 missense probably benign 0.07
R1597:Polr2a UTSW 11 69739929 missense possibly damaging 0.88
R1614:Polr2a UTSW 11 69743373 missense possibly damaging 0.75
R1698:Polr2a UTSW 11 69739877 critical splice donor site probably null
R1735:Polr2a UTSW 11 69742396 missense probably damaging 0.99
R1743:Polr2a UTSW 11 69739503 missense probably damaging 0.96
R1899:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1900:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R2217:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2218:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2245:Polr2a UTSW 11 69735183 missense unknown
R3123:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R3124:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R4018:Polr2a UTSW 11 69735059 missense unknown
R4025:Polr2a UTSW 11 69743659 missense possibly damaging 0.95
R4197:Polr2a UTSW 11 69735336 missense unknown
R4462:Polr2a UTSW 11 69746403 missense probably damaging 1.00
R4508:Polr2a UTSW 11 69742559 critical splice acceptor site probably null
R4746:Polr2a UTSW 11 69735674 missense probably benign 0.05
R5069:Polr2a UTSW 11 69736735 intron probably null
R5102:Polr2a UTSW 11 69746945 missense possibly damaging 0.93
R5195:Polr2a UTSW 11 69744079 missense probably damaging 1.00
R5234:Polr2a UTSW 11 69736840 missense probably benign 0.03
R5330:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5331:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5896:Polr2a UTSW 11 69736260 missense probably damaging 0.99
R5910:Polr2a UTSW 11 69746870 missense probably damaging 0.99
R6128:Polr2a UTSW 11 69736977 missense probably damaging 1.00
R6238:Polr2a UTSW 11 69747221 missense possibly damaging 0.95
R6244:Polr2a UTSW 11 69744226 missense probably damaging 1.00
R6303:Polr2a UTSW 11 69746913 missense probably damaging 1.00
R6338:Polr2a UTSW 11 69739679 intron probably null
R6361:Polr2a UTSW 11 69743337 missense probably damaging 0.99
R6374:Polr2a UTSW 11 69736932 missense probably damaging 0.98
R6630:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6631:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6633:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6897:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6923:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6933:Polr2a UTSW 11 69736177 missense probably damaging 0.99
R6933:Polr2a UTSW 11 69739467 missense probably benign 0.03
R6953:Polr2a UTSW 11 69741711 missense probably damaging 0.99
R6974:Polr2a UTSW 11 69747200 missense probably damaging 0.98
R7033:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R7085:Polr2a UTSW 11 69743880 missense probably damaging 0.99
R7112:Polr2a UTSW 11 69735309 missense unknown
R7124:Polr2a UTSW 11 69737462 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGAGATGTCGGTGAGTAGC -3'
(R):5'- TCTCCCAGCTACTCACCGAC -3'

Sequencing Primer
(F):5'- AGAATAGCTTGGTGAAGTTGGTGAG -3'
(R):5'- GACATCACCAGCCTATGAGC -3'
Posted On2014-07-14