Incidental Mutation 'R1933:Tlr1'
ID215550
Institutional Source Beutler Lab
Gene Symbol Tlr1
Ensembl Gene ENSMUSG00000044827
Gene Nametoll-like receptor 1
Synonyms
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location64924679-64933563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64925438 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 599 (T599P)
Ref Sequence ENSEMBL: ENSMUSP00000142500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059349
AA Change: T599P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: T599P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000197315
AA Change: T599P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: T599P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
Pfam:LRR_1 97 114 2.3e-2 PFAM
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Tlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tlr1 APN 5 64926434 missense probably benign 0.01
IGL01324:Tlr1 APN 5 64925179 missense probably damaging 1.00
IGL01564:Tlr1 APN 5 64925846 missense probably damaging 1.00
IGL01663:Tlr1 APN 5 64925073 missense possibly damaging 0.48
IGL01689:Tlr1 APN 5 64925779 missense probably damaging 0.97
IGL01749:Tlr1 APN 5 64925947 nonsense probably null
IGL01751:Tlr1 APN 5 64925947 nonsense probably null
IGL01769:Tlr1 APN 5 64925947 nonsense probably null
IGL01899:Tlr1 APN 5 64927016 missense probably damaging 0.97
IGL02197:Tlr1 APN 5 64926454 missense probably damaging 1.00
IGL02295:Tlr1 APN 5 64925947 nonsense probably null
IGL02308:Tlr1 APN 5 64925947 nonsense probably null
IGL02309:Tlr1 APN 5 64925947 nonsense probably null
IGL02311:Tlr1 APN 5 64925947 nonsense probably null
IGL02591:Tlr1 APN 5 64926716 missense probably damaging 1.00
IGL02739:Tlr1 APN 5 64927126 missense probably benign 0.41
IGL03206:Tlr1 APN 5 64925057 missense probably damaging 0.99
IGL03055:Tlr1 UTSW 5 64926596 missense probably benign 0.05
R0315:Tlr1 UTSW 5 64926928 missense probably damaging 0.99
R0317:Tlr1 UTSW 5 64925967 nonsense probably null
R0511:Tlr1 UTSW 5 64926620 missense probably damaging 0.98
R1539:Tlr1 UTSW 5 64926976 missense probably damaging 1.00
R1552:Tlr1 UTSW 5 64926860 missense probably damaging 1.00
R1835:Tlr1 UTSW 5 64925700 missense probably benign 0.01
R1956:Tlr1 UTSW 5 64925177 missense probably damaging 1.00
R2099:Tlr1 UTSW 5 64925068 missense probably damaging 1.00
R2507:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2508:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2937:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R2938:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R3033:Tlr1 UTSW 5 64925569 missense probably damaging 1.00
R4164:Tlr1 UTSW 5 64927202 missense possibly damaging 0.47
R4226:Tlr1 UTSW 5 64925717 missense probably damaging 0.96
R4366:Tlr1 UTSW 5 64925837 missense probably benign 0.00
R5009:Tlr1 UTSW 5 64926224 missense probably damaging 1.00
R5029:Tlr1 UTSW 5 64925681 missense probably damaging 0.97
R5069:Tlr1 UTSW 5 64926400 missense probably benign 0.01
R5186:Tlr1 UTSW 5 64925221 missense probably damaging 1.00
R5336:Tlr1 UTSW 5 64925802 missense probably damaging 1.00
R5500:Tlr1 UTSW 5 64927098 missense probably benign 0.08
R5503:Tlr1 UTSW 5 64926292 missense probably damaging 0.99
R5577:Tlr1 UTSW 5 64926085 missense possibly damaging 0.94
R6141:Tlr1 UTSW 5 64925213 missense possibly damaging 0.92
R6210:Tlr1 UTSW 5 64925286 missense probably damaging 1.00
R6238:Tlr1 UTSW 5 64927129 missense possibly damaging 0.86
R6284:Tlr1 UTSW 5 64927099 missense possibly damaging 0.93
R6311:Tlr1 UTSW 5 64926845 missense probably damaging 0.99
R7021:Tlr1 UTSW 5 64925713 missense possibly damaging 0.75
R7140:Tlr1 UTSW 5 64925678 missense not run
X0067:Tlr1 UTSW 5 64926575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGGCAAATCTGGATGTCATC -3'
(R):5'- TGAGCTGAGGGACTTTGTCAAG -3'

Sequencing Primer
(F):5'- GGTAGTAATTCGTTCTTCACCCAGG -3'
(R):5'- CTTTGTCAAGAACATAGGCTGG -3'
Posted On2014-07-14