Incidental Mutation 'R1933:Cd300c2'
ID215601
Institutional Source Beutler Lab
Gene Symbol Cd300c2
Ensembl Gene ENSMUSG00000044811
Gene NameCD300C molecule 2
SynonymsClm4, Cd300d, LMIR2, MAIR-II, AF251705, DIgR1, Igsf7
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location114996721-115001880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115000859 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 63 (V63E)
Ref Sequence ENSEMBL: ENSMUSP00000090121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092464] [ENSMUST00000141188]
Predicted Effect probably benign
Transcript: ENSMUST00000092464
AA Change: V63E

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090121
Gene: ENSMUSG00000044811
AA Change: V63E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 28 134 1.52e-3 SMART
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141188
SMART Domains Protein: ENSMUSP00000124035
Gene: ENSMUSG00000044811

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased stimulated B cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Cd300c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cd300c2 APN 11 115001549 utr 5 prime probably benign
IGL02695:Cd300c2 APN 11 115001553 utr 5 prime probably benign
IGL03086:Cd300c2 APN 11 115000823 missense possibly damaging 0.76
R4707:Cd300c2 UTSW 11 114996985 missense probably benign 0.03
R4866:Cd300c2 UTSW 11 115000981 nonsense probably null
R4900:Cd300c2 UTSW 11 115000981 nonsense probably null
R4906:Cd300c2 UTSW 11 114997000 missense possibly damaging 0.85
R4908:Cd300c2 UTSW 11 114996946 missense probably damaging 0.97
R4946:Cd300c2 UTSW 11 114996905 missense probably benign 0.04
R5568:Cd300c2 UTSW 11 115000836 missense probably damaging 1.00
R6870:Cd300c2 UTSW 11 115000677 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCCTCACTTGGAACCACAG -3'
(R):5'- AGGACTTACTCCCATCCAGC -3'

Sequencing Primer
(F):5'- TTGAAGTACTTATCGAACCCCAAGG -3'
(R):5'- CTGTCAGGGTGCAGAATTGAAGTTAC -3'
Posted On2014-07-14