Incidental Mutation 'R1936:Ccdc129'
ID215796
Institutional Source Beutler Lab
Gene Symbol Ccdc129
Ensembl Gene ENSMUSG00000037973
Gene Namecoiled-coil domain containing 129
SynonymsD530004J12Rik
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.025) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55836895-55978735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55897681 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 205 (L205F)
Ref Sequence ENSEMBL: ENSMUSP00000045332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044729]
Predicted Effect probably damaging
Transcript: ENSMUST00000044729
AA Change: L205F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045332
Gene: ENSMUSG00000037973
AA Change: L205F

DomainStartEndE-ValueType
KRAP_IP3R_bind 112 264 2.99e-82 SMART
low complexity region 326 334 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
low complexity region 477 496 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
low complexity region 781 789 N/A INTRINSIC
Pfam:SSFA2_C 806 916 3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169699
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Ccdc129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ccdc129 APN 6 55968037 missense possibly damaging 0.90
IGL01317:Ccdc129 APN 6 55967805 missense possibly damaging 0.77
IGL01390:Ccdc129 APN 6 55897998 missense probably benign 0.41
IGL01696:Ccdc129 APN 6 55897695 missense probably benign 0.40
IGL01941:Ccdc129 APN 6 55968045 missense probably benign
IGL01967:Ccdc129 APN 6 55897911 missense probably damaging 0.99
IGL02071:Ccdc129 APN 6 55967725 nonsense probably null
IGL02232:Ccdc129 APN 6 55967937 missense unknown
IGL02268:Ccdc129 APN 6 55884688 splice site probably benign
IGL02440:Ccdc129 APN 6 55884728 missense possibly damaging 0.95
IGL02614:Ccdc129 APN 6 55968277 missense probably damaging 0.99
IGL02626:Ccdc129 APN 6 55968646 missense probably benign 0.03
IGL02674:Ccdc129 APN 6 55897928 missense probably benign 0.04
IGL02836:Ccdc129 APN 6 55898090 missense probably damaging 1.00
IGL02884:Ccdc129 APN 6 55874354 splice site probably null
IGL02889:Ccdc129 APN 6 55901458 missense possibly damaging 0.46
IGL03103:Ccdc129 APN 6 55968159 missense possibly damaging 0.59
IGL03117:Ccdc129 APN 6 55898129 missense probably benign 0.25
IGL03343:Ccdc129 APN 6 55968584 missense probably damaging 1.00
R0054:Ccdc129 UTSW 6 55872472 utr 5 prime probably benign
R0200:Ccdc129 UTSW 6 55897956 missense probably benign 0.10
R0245:Ccdc129 UTSW 6 55898007 missense probably damaging 1.00
R0320:Ccdc129 UTSW 6 55976447 missense probably damaging 1.00
R0326:Ccdc129 UTSW 6 55898243 missense possibly damaging 0.61
R0357:Ccdc129 UTSW 6 55968034 missense probably benign 0.13
R1109:Ccdc129 UTSW 6 55968260 missense probably damaging 1.00
R1118:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1119:Ccdc129 UTSW 6 55889170 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1462:Ccdc129 UTSW 6 55975664 missense probably damaging 1.00
R1588:Ccdc129 UTSW 6 55978503 missense possibly damaging 0.72
R1678:Ccdc129 UTSW 6 55968514 missense probably benign 0.35
R1680:Ccdc129 UTSW 6 55968766 missense probably damaging 1.00
R1728:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1729:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1737:Ccdc129 UTSW 6 55968304 missense probably damaging 1.00
R1771:Ccdc129 UTSW 6 55898147 missense probably benign 0.40
R1784:Ccdc129 UTSW 6 55968541 missense probably benign 0.01
R1995:Ccdc129 UTSW 6 55968709 missense probably benign 0.03
R2037:Ccdc129 UTSW 6 55897875 missense probably benign 0.00
R2137:Ccdc129 UTSW 6 55889189 missense probably damaging 1.00
R2190:Ccdc129 UTSW 6 55897700 missense possibly damaging 0.87
R2191:Ccdc129 UTSW 6 55967719 missense probably benign 0.06
R2234:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R2235:Ccdc129 UTSW 6 55897812 missense possibly damaging 0.67
R3793:Ccdc129 UTSW 6 55975603 missense possibly damaging 0.80
R3923:Ccdc129 UTSW 6 55968060 missense probably benign 0.19
R3959:Ccdc129 UTSW 6 55897740 missense probably benign
R4332:Ccdc129 UTSW 6 55968235 missense possibly damaging 0.95
R4485:Ccdc129 UTSW 6 55887066 missense probably benign 0.00
R4688:Ccdc129 UTSW 6 55967147 splice site probably null
R4916:Ccdc129 UTSW 6 55978190 missense possibly damaging 0.77
R5201:Ccdc129 UTSW 6 55968006 missense probably benign 0.03
R5383:Ccdc129 UTSW 6 55978290 missense probably benign 0.38
R5450:Ccdc129 UTSW 6 55968811 critical splice donor site probably null
R5542:Ccdc129 UTSW 6 55978395 missense probably damaging 0.99
R5819:Ccdc129 UTSW 6 55897891 missense probably benign 0.18
R5935:Ccdc129 UTSW 6 55897769 nonsense probably null
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6034:Ccdc129 UTSW 6 55967681 missense possibly damaging 0.94
R6209:Ccdc129 UTSW 6 55874321 missense probably damaging 1.00
R6246:Ccdc129 UTSW 6 55967672 missense probably damaging 1.00
R6463:Ccdc129 UTSW 6 55968678 missense probably benign 0.17
R6490:Ccdc129 UTSW 6 55976420 missense probably damaging 1.00
R6948:Ccdc129 UTSW 6 55978485 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACATTATCCATTCTACAAGCTTG -3'
(R):5'- GCTCGTCTGTCTTGAAGCTC -3'

Sequencing Primer
(F):5'- GTGTACATTCCACACACGTG -3'
(R):5'- GAAGCTCTTTTTAAAAGTTGGCTC -3'
Posted On2014-07-14