Incidental Mutation 'R0243:Sspo'
ID215990
Institutional Source Beutler Lab
Gene Symbol Sspo
Ensembl Gene ENSMUSG00000029797
Gene NameSCO-spondin
SynonymsScospondin, C79529
MMRRC Submission 038481-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0243 (G1)
Quality Score34
Status Validated
Chromosome6
Chromosomal Location48448229-48501250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48493186 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 4520 (P4520T)
Ref Sequence ENSEMBL: ENSMUSP00000148570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000185370] [ENSMUST00000188970] [ENSMUST00000212740]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043676
AA Change: P4386T

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: P4386T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
Pfam:VWD 154 219 7.4e-11 PFAM
C8 267 346 2.3e-10 SMART
Pfam:TIL 349 404 3.2e-13 PFAM
VWC 406 448 2e-1 SMART
VWD 433 593 5.08e-29 SMART
C8 631 703 2.14e-28 SMART
Pfam:TIL 706 759 5.8e-11 PFAM
VWC 856 924 4.76e-2 SMART
VWD 883 1042 9.59e-48 SMART
C8 1076 1150 3.62e-26 SMART
Pfam:TIL 1153 1209 2.6e-13 PFAM
LDLa 1253 1291 2.29e-13 SMART
LDLa 1293 1328 1.87e-9 SMART
LDLa 1329 1366 5.77e-10 SMART
LDLa 1369 1408 1.52e-9 SMART
LDLa 1442 1479 2.55e-11 SMART
LDLa 1480 1520 5.6e-8 SMART
LDLa 1533 1574 2.29e-4 SMART
TSP1 1575 1626 6.47e-13 SMART
TSP1 1631 1686 1.35e-10 SMART
Pfam:TIL 1690 1746 3.1e-9 PFAM
TSP1 1774 1827 6.94e-2 SMART
VWC 1829 1886 4.95e-9 SMART
low complexity region 1901 1911 N/A INTRINSIC
FA58C 1928 2085 1.4e-2 SMART
LDLa 2091 2128 1.48e-7 SMART
LDLa 2242 2279 5.68e-9 SMART
LDLa 2299 2336 5.77e-10 SMART
TSP1 2339 2389 1.42e-9 SMART
TSP1 2394 2446 6.36e-21 SMART
Pfam:TIL 2460 2511 5.7e-10 PFAM
VWC 2513 2567 2.48e-1 SMART
TSP1 2554 2605 3.07e-14 SMART
TSP1 2611 2664 4.05e-5 SMART
TSP1 2669 2719 1.83e-12 SMART
EGF_like 2733 2776 5.45e1 SMART
VWC 2783 2836 2.73e-11 SMART
TSP1 2823 2875 3.72e-13 SMART
TSP1 2878 2919 6.05e-4 SMART
Pfam:TIL 2926 2978 1.1e-11 PFAM
VWC 2980 3035 9.77e-2 SMART
TSP1 3022 3086 6.68e-6 SMART
TSP1 3091 3143 1.08e-14 SMART
Pfam:TIL 3147 3201 2.2e-9 PFAM
VWC 3203 3260 2.72e-1 SMART
TSP1 3247 3306 3.72e-4 SMART
TSP1 3311 3363 5.27e-4 SMART
Pfam:TIL 3365 3421 4.2e-9 PFAM
TSP1 3484 3529 1.87e-9 SMART
low complexity region 3591 3601 N/A INTRINSIC
TSP1 3660 3713 5.02e-10 SMART
TSP1 3730 3779 2.95e-7 SMART
TSP1 3796 3849 1.99e-13 SMART
TSP1 3854 3906 2.51e-10 SMART
Pfam:TIL 3909 3964 3.4e-11 PFAM
VWC 3966 4022 1.26e0 SMART
TSP1 4009 4059 4.05e-5 SMART
TSP1 4103 4155 3.19e-12 SMART
TSP1 4161 4213 2.87e-2 SMART
TSP1 4218 4269 1.45e-6 SMART
Pfam:TIL 4273 4328 2.1e-10 PFAM
TSP1 4468 4516 7.56e-5 SMART
low complexity region 4551 4562 N/A INTRINSIC
VWC 4578 4652 5.21e-1 SMART
TSP1 4619 4669 3.92e-12 SMART
Pfam:TIL 4671 4725 1.5e-11 PFAM
Pfam:TIL 4777 4835 3.1e-9 PFAM
VWC 4837 4892 1.8e-11 SMART
GHB 4904 4997 1.02e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169350
AA Change: P4529T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: P4529T

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 126 135 N/A INTRINSIC
VWD 185 341 4.36e-28 SMART
C8 390 469 2.3e-10 SMART
Pfam:TIL 472 527 8.6e-13 PFAM
VWC 529 571 2e-1 SMART
VWD 556 716 5.08e-29 SMART
C8 754 826 2.14e-28 SMART
Pfam:TIL 829 882 1.6e-10 PFAM
VWC 979 1047 4.76e-2 SMART
VWD 1006 1165 9.59e-48 SMART
C8 1201 1275 3.62e-26 SMART
Pfam:TIL 1278 1334 7e-13 PFAM
LDLa 1378 1416 2.29e-13 SMART
LDLa 1418 1453 1.87e-9 SMART
LDLa 1454 1491 5.77e-10 SMART
LDLa 1494 1533 1.52e-9 SMART
LDLa 1567 1604 2.55e-11 SMART
LDLa 1605 1645 5.6e-8 SMART
LDLa 1658 1699 2.29e-4 SMART
TSP1 1700 1751 6.47e-13 SMART
TSP1 1756 1811 1.35e-10 SMART
Pfam:TIL 1815 1871 8.3e-9 PFAM
VWC 1873 1928 2.42e-1 SMART
TSP1 1915 1968 6.94e-2 SMART
VWC 1970 2027 4.95e-9 SMART
low complexity region 2042 2052 N/A INTRINSIC
FA58C 2069 2226 1.4e-2 SMART
LDLa 2232 2269 1.48e-7 SMART
LDLa 2387 2424 5.68e-9 SMART
LDLa 2444 2481 5.77e-10 SMART
TSP1 2484 2534 1.42e-9 SMART
TSP1 2539 2591 6.36e-21 SMART
Pfam:TIL 2606 2656 1.8e-9 PFAM
VWC 2658 2712 2.48e-1 SMART
TSP1 2699 2750 3.07e-14 SMART
TSP1 2756 2809 4.05e-5 SMART
TSP1 2814 2864 1.83e-12 SMART
EGF_like 2878 2921 5.45e1 SMART
VWC 2928 2981 2.73e-11 SMART
TSP1 2968 3020 3.72e-13 SMART
TSP1 3023 3064 6.05e-4 SMART
Pfam:TIL 3071 3123 3e-11 PFAM
VWC 3125 3180 9.77e-2 SMART
TSP1 3167 3231 6.68e-6 SMART
TSP1 3236 3288 1.08e-14 SMART
Pfam:TIL 3292 3346 6e-9 PFAM
VWC 3348 3405 2.72e-1 SMART
TSP1 3392 3451 3.72e-4 SMART
TSP1 3456 3508 5.27e-4 SMART
Pfam:TIL 3510 3566 1.1e-8 PFAM
TSP1 3629 3674 1.87e-9 SMART
low complexity region 3734 3744 N/A INTRINSIC
TSP1 3803 3856 5.02e-10 SMART
TSP1 3873 3922 2.95e-7 SMART
TSP1 3939 3992 1.99e-13 SMART
TSP1 3997 4049 2.51e-10 SMART
Pfam:TIL 4052 4107 9.1e-11 PFAM
VWC 4109 4165 1.26e0 SMART
TSP1 4152 4202 4.05e-5 SMART
TSP1 4246 4298 3.19e-12 SMART
TSP1 4304 4356 2.87e-2 SMART
TSP1 4361 4412 1.45e-6 SMART
Pfam:TIL 4416 4471 5.6e-10 PFAM
TSP1 4611 4659 7.56e-5 SMART
low complexity region 4694 4705 N/A INTRINSIC
VWC 4721 4795 5.21e-1 SMART
TSP1 4762 4812 3.92e-12 SMART
Pfam:TIL 4814 4868 4e-11 PFAM
Pfam:TIL 4920 4978 8.4e-9 PFAM
VWC 4980 5035 1.8e-11 SMART
GHB 5050 5143 1.02e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185370
AA Change: P560T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139484
Gene: ENSMUSG00000029797
AA Change: P560T

DomainStartEndE-ValueType
TSP1 28 80 1.2e-12 SMART
Pfam:TIL 83 138 3.8e-9 PFAM
VWC 140 196 6e-3 SMART
TSP1 183 233 1.9e-7 SMART
TSP1 277 329 1.5e-14 SMART
TSP1 335 387 1.4e-4 SMART
TSP1 392 443 6.8e-9 SMART
Pfam:TIL 447 502 2e-8 PFAM
Blast:TSP1 549 637 2e-11 BLAST
TSP1 642 690 3.7e-7 SMART
Pfam:TIL 694 750 1.3e-7 PFAM
VWC_def 752 826 2.5e-3 SMART
TSP1 793 843 1.9e-14 SMART
Pfam:TIL 845 899 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188970
SMART Domains Protein: ENSMUSP00000140642
Gene: ENSMUSG00000029797

DomainStartEndE-ValueType
Pfam:TSP_1 1 40 9.4e-5 PFAM
TSP1 105 155 1.9e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212740
AA Change: P4520T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 98% (148/151)
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T G 5: 63,898,463 Y181D probably benign Het
1110034G24Rik T C 2: 132,750,639 V202A probably benign Het
1700029H14Rik A G 8: 13,554,715 V196A possibly damaging Het
2410004B18Rik A G 3: 145,938,078 D7G probably damaging Het
2810474O19Rik T C 6: 149,326,241 Y262H probably damaging Het
Acap1 A G 11: 69,885,426 V249A probably damaging Het
Acat2 A T 17: 12,944,021 D313E probably benign Het
Actn4 T C 7: 28,905,398 T325A probably benign Het
Adamdec1 C T 14: 68,581,958 probably null Het
Adat2 A G 10: 13,553,293 T10A probably benign Het
Aff4 T A 11: 53,397,858 S400R possibly damaging Het
Agbl2 C T 2: 90,791,481 P104L possibly damaging Het
Alox12 G T 11: 70,242,716 T594K possibly damaging Het
Als2 C A 1: 59,215,387 K270N probably benign Het
Ankhd1 T A 18: 36,634,734 C1235S probably damaging Het
Ankrd24 T A 10: 81,634,944 I69N probably damaging Het
Aox4 G A 1: 58,213,076 V37I probably benign Het
Arfgap3 A G 15: 83,330,513 probably benign Het
Arhgef4 T A 1: 34,806,999 probably null Het
Asic1 C T 15: 99,698,617 probably benign Het
Atp8b5 A G 4: 43,366,057 N776S probably benign Het
Bbs7 A G 3: 36,605,734 I184T probably benign Het
Bbs9 A T 9: 22,514,001 H117L probably damaging Het
Bnip2 T C 9: 69,995,505 W10R probably damaging Het
Brd4 G T 17: 32,224,123 Q175K probably benign Het
Bysl A T 17: 47,606,896 V124E possibly damaging Het
Cadm3 A G 1: 173,346,573 probably benign Het
Cc2d2a T C 5: 43,696,638 probably benign Het
Ccdc134 G T 15: 82,140,946 E215D probably damaging Het
Celsr3 G T 9: 108,843,724 probably benign Het
Cntn5 T A 9: 9,781,775 D428V probably damaging Het
Cog1 A G 11: 113,656,995 probably benign Het
Col11a2 G T 17: 34,062,546 probably benign Het
Cyp4f13 G A 17: 32,924,969 probably benign Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Dffb T A 4: 153,965,378 K343* probably null Het
Dnah9 T A 11: 65,911,852 I224F possibly damaging Het
Dolk A T 2: 30,286,019 C5S probably benign Het
Ebf1 A T 11: 44,869,088 probably benign Het
Elac1 A G 18: 73,742,363 L199P probably damaging Het
Elmod1 A C 9: 53,935,547 probably benign Het
Ep400 A C 5: 110,724,407 probably benign Het
F10 A T 8: 13,048,196 N133I probably damaging Het
Fasn A G 11: 120,815,315 Y1068H probably benign Het
Fbxo24 T C 5: 137,624,557 E12G probably damaging Het
Fer G T 17: 64,078,946 L304F probably benign Het
Filip1 A C 9: 79,819,003 L778R probably damaging Het
Fli1 A T 9: 32,423,981 I385N probably benign Het
Fpgs A T 2: 32,692,494 L89* probably null Het
Gab2 T G 7: 97,299,241 I346R probably damaging Het
Gm10764 G A 10: 87,290,979 G83R unknown Het
Gpr83 G T 9: 14,864,842 C153F possibly damaging Het
Gtf3c3 A G 1: 54,403,536 L783P possibly damaging Het
Gys2 A G 6: 142,472,668 probably benign Het
Heatr9 C T 11: 83,513,338 V378I possibly damaging Het
Helz A T 11: 107,637,914 Y920F possibly damaging Het
Inpp5f A T 7: 128,695,183 Q459L probably damaging Het
Ints12 T C 3: 133,109,045 S338P probably benign Het
Kif13a T C 13: 46,791,351 T925A probably benign Het
Kif1a C T 1: 93,042,093 V1051I probably damaging Het
Kif7 T A 7: 79,699,560 H1119L possibly damaging Het
Kmt2d C T 15: 98,850,137 probably benign Het
Krt90 C T 15: 101,562,675 G51S possibly damaging Het
Krtap31-2 A T 11: 99,936,746 I135F possibly damaging Het
Lrp2 T C 2: 69,428,630 E4572G probably benign Het
Mapk8ip1 T C 2: 92,385,944 E493G probably damaging Het
Matk T G 10: 81,258,492 L28V probably benign Het
Mcc T A 18: 44,759,299 T83S probably benign Het
Mtch1 A T 17: 29,340,106 M204K possibly damaging Het
Muc4 T G 16: 32,765,746 C2622G possibly damaging Het
Myo5a G A 9: 75,186,123 probably null Het
Myoz3 T C 18: 60,578,951 Y185C probably damaging Het
Nnmt A G 9: 48,592,138 V196A probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nup214 T A 2: 31,998,057 probably benign Het
Olfr1261 T A 2: 89,993,806 F138I probably benign Het
Olfr1383 T C 11: 49,523,912 L63P probably damaging Het
Olfr169 T G 16: 19,566,294 E196D probably damaging Het
Pank3 T C 11: 35,781,716 probably benign Het
Parm1 A T 5: 91,594,294 N174Y possibly damaging Het
Pcgf2 A T 11: 97,692,418 probably null Het
Pclo A T 5: 14,775,420 K4661M unknown Het
Pcsk7 A C 9: 45,916,059 S375R probably damaging Het
Pdzrn4 G T 15: 92,770,319 S784I possibly damaging Het
Pex6 T A 17: 46,723,737 probably null Het
Pi4ka C T 16: 17,297,635 V1384M probably benign Het
Polr3f T A 2: 144,536,275 probably benign Het
Ppp2r3a A T 9: 101,212,284 V280E probably damaging Het
Prdm14 C T 1: 13,122,448 G356R probably damaging Het
Prepl A G 17: 85,065,038 probably null Het
Primpol T C 8: 46,599,814 D154G probably damaging Het
Ptchd4 A C 17: 42,503,416 H736P probably damaging Het
Rab11fip1 A G 8: 27,152,225 S849P probably damaging Het
Rap1gap T A 4: 137,719,351 D405E probably damaging Het
Rbm26 T C 14: 105,131,938 T686A probably benign Het
Rint1 A G 5: 23,816,932 probably benign Het
Rnasek G T 11: 70,238,440 Y62* probably null Het
Rnf17 T G 14: 56,482,084 N930K possibly damaging Het
Sap130 A G 18: 31,680,681 probably benign Het
Sectm1b T A 11: 121,055,785 I95F probably damaging Het
Sema4f A T 6: 82,939,466 I53N possibly damaging Het
Siglec1 T C 2: 131,085,476 T137A probably damaging Het
Six5 A C 7: 19,097,022 probably null Het
Slc22a30 A T 19: 8,345,357 I345N probably benign Het
Slc25a27 A T 17: 43,643,627 M316K probably benign Het
Slc2a8 A T 2: 32,980,104 probably benign Het
Snx1 G A 9: 66,101,326 probably benign Het
Spag17 A G 3: 100,085,368 T1727A probably benign Het
Spata20 T C 11: 94,481,646 D633G probably benign Het
Spock1 C T 13: 57,436,109 probably null Het
Sra1 A T 18: 36,675,706 Y291* probably null Het
Stat4 A G 1: 52,011,857 N25S probably benign Het
Tbx18 A T 9: 87,715,516 probably benign Het
Tctex1d2 A G 16: 32,426,887 D118G probably damaging Het
Tep1 T A 14: 50,846,987 I187F probably damaging Het
Tfap2b A T 1: 19,234,123 I368F probably damaging Het
Tmtc1 A T 6: 148,246,837 L711Q probably damaging Het
Tmx3 T A 18: 90,538,489 probably benign Het
Tnc G T 4: 63,970,420 T1803K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tpgs1 C T 10: 79,675,866 P281S probably benign Het
Trim45 A G 3: 100,929,844 R499G probably benign Het
Tulp3 A T 6: 128,325,958 Y299* probably null Het
Ube4a A T 9: 44,946,178 probably benign Het
Ubr3 T G 2: 69,951,405 S642R probably damaging Het
Vcpip1 A T 1: 9,747,206 Y317* probably null Het
Vmn1r115 G A 7: 20,844,402 T195I probably benign Het
Vmn1r226 G A 17: 20,687,577 V24I probably benign Het
Wdr41 C T 13: 95,017,406 A321V probably damaging Het
Wfdc5 T C 2: 164,178,835 N44D probably benign Het
Wnt7b C A 15: 85,558,902 probably null Het
Zfp108 T C 7: 24,261,783 S600P possibly damaging Het
Zfp385b A G 2: 77,415,728 probably null Het
Zfp395 T C 14: 65,386,480 S133P probably benign Het
Zfp407 T A 18: 84,558,711 M1426L probably damaging Het
Zfp641 T G 15: 98,289,127 N191T possibly damaging Het
Zfp687 T C 3: 95,011,553 S303G probably damaging Het
Zfp759 T A 13: 67,138,813 F143I possibly damaging Het
Zgrf1 G C 3: 127,615,446 E1690Q probably damaging Het
Other mutations in Sspo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Sspo APN 6 48470453 missense probably benign 0.02
IGL00339:Sspo APN 6 48483746 splice site probably benign
IGL00391:Sspo APN 6 48497386 missense probably damaging 0.96
IGL00433:Sspo APN 6 48490036 missense probably damaging 1.00
IGL00471:Sspo APN 6 48498213 splice site probably benign
IGL00500:Sspo APN 6 48497421 nonsense probably null
IGL00537:Sspo APN 6 48498213 splice site probably benign
IGL00540:Sspo APN 6 48498213 splice site probably benign
IGL01060:Sspo APN 6 48449479 nonsense probably null
IGL01090:Sspo APN 6 48490125 missense probably benign 0.08
IGL01125:Sspo APN 6 48492888 missense probably damaging 1.00
IGL01447:Sspo APN 6 48464666 splice site probably null
IGL01457:Sspo APN 6 48498343 missense probably benign 0.00
IGL01481:Sspo APN 6 48448515 missense probably benign 0.41
IGL01485:Sspo APN 6 48478731 missense probably damaging 1.00
IGL01544:Sspo APN 6 48491019 missense probably damaging 0.99
IGL01575:Sspo APN 6 48459042 missense probably benign 0.01
IGL01589:Sspo APN 6 48451178 missense probably damaging 1.00
IGL01601:Sspo APN 6 48486379 missense probably benign 0.33
IGL01644:Sspo APN 6 48452502 missense probably benign
IGL01659:Sspo APN 6 48474443 missense probably damaging 1.00
IGL01801:Sspo APN 6 48457138 missense probably damaging 1.00
IGL01872:Sspo APN 6 48454689 missense probably damaging 0.99
IGL01874:Sspo APN 6 48452190 missense probably damaging 1.00
IGL01936:Sspo APN 6 48475887 missense probably damaging 1.00
IGL01941:Sspo APN 6 48495182 missense probably benign 0.19
IGL01986:Sspo APN 6 48483303 missense probably benign 0.05
IGL01987:Sspo APN 6 48477624 splice site probably null
IGL02170:Sspo APN 6 48467983 missense possibly damaging 0.76
IGL02192:Sspo APN 6 48459568 missense possibly damaging 0.86
IGL02210:Sspo APN 6 48500492 missense probably damaging 1.00
IGL02225:Sspo APN 6 48484334 missense probably benign 0.09
IGL02280:Sspo APN 6 48496231 missense probably damaging 1.00
IGL02303:Sspo APN 6 48484705 missense possibly damaging 0.52
IGL02397:Sspo APN 6 48461638 missense probably benign 0.35
IGL02451:Sspo APN 6 48460303 splice site probably benign
IGL02500:Sspo APN 6 48478379 nonsense probably null
IGL02519:Sspo APN 6 48484828 missense probably damaging 1.00
IGL02549:Sspo APN 6 48451773 missense possibly damaging 0.81
IGL02562:Sspo APN 6 48490122 unclassified probably null
IGL02673:Sspo APN 6 48475860 missense probably damaging 1.00
IGL02673:Sspo APN 6 48498775 critical splice donor site probably null
IGL02719:Sspo APN 6 48482667 missense probably benign 0.39
IGL02793:Sspo APN 6 48487894 splice site probably benign
IGL03003:Sspo APN 6 48455087 missense probably damaging 0.98
IGL03056:Sspo APN 6 48470538 missense probably benign 0.17
IGL03105:Sspo APN 6 48473658 splice site probably benign
IGL03116:Sspo APN 6 48494101 missense probably benign 0.32
IGL03163:Sspo APN 6 48484332 missense probably benign 0.19
IGL03198:Sspo APN 6 48477582 missense probably benign 0.31
IGL03365:Sspo APN 6 48459415 missense possibly damaging 0.82
Barrier UTSW 6 48495212 missense possibly damaging 0.58
ANU74:Sspo UTSW 6 48460959 missense probably damaging 1.00
IGL02984:Sspo UTSW 6 48495155 missense probably benign 0.33
IGL03052:Sspo UTSW 6 48460453 missense probably damaging 1.00
IGL03134:Sspo UTSW 6 48451065 missense probably benign 0.28
PIT4531001:Sspo UTSW 6 48481239 missense probably benign
R0087:Sspo UTSW 6 48477785 missense probably damaging 1.00
R0122:Sspo UTSW 6 48473976 missense possibly damaging 0.95
R0129:Sspo UTSW 6 48455418 missense probably benign 0.00
R0164:Sspo UTSW 6 48494194 splice site probably benign
R0195:Sspo UTSW 6 48486636 missense probably benign
R0200:Sspo UTSW 6 48486415 missense probably null 0.01
R0201:Sspo UTSW 6 48455752 missense possibly damaging 0.64
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0241:Sspo UTSW 6 48461495 missense possibly damaging 0.82
R0268:Sspo UTSW 6 48465555 missense probably benign 0.26
R0312:Sspo UTSW 6 48455401 missense possibly damaging 0.52
R0449:Sspo UTSW 6 48466740 missense probably damaging 1.00
R0523:Sspo UTSW 6 48451860 missense probably benign 0.20
R0576:Sspo UTSW 6 48464942 splice site probably null
R0671:Sspo UTSW 6 48490391 splice site probably benign
R0828:Sspo UTSW 6 48498734 missense probably damaging 1.00
R0880:Sspo UTSW 6 48475935 missense possibly damaging 0.69
R0903:Sspo UTSW 6 48455308 critical splice acceptor site probably null
R1051:Sspo UTSW 6 48491455 nonsense probably null
R1083:Sspo UTSW 6 48470999 missense possibly damaging 0.91
R1109:Sspo UTSW 6 48497443 missense probably damaging 1.00
R1118:Sspo UTSW 6 48459418 missense probably damaging 0.97
R1256:Sspo UTSW 6 48457639 missense probably damaging 1.00
R1342:Sspo UTSW 6 48461635 missense probably benign 0.07
R1355:Sspo UTSW 6 48448626 missense probably benign 0.41
R1370:Sspo UTSW 6 48448626 missense probably benign 0.41
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1469:Sspo UTSW 6 48490982 missense probably damaging 1.00
R1476:Sspo UTSW 6 48463400 critical splice donor site probably null
R1566:Sspo UTSW 6 48466870 critical splice donor site probably null
R1630:Sspo UTSW 6 48457724 missense probably benign 0.01
R1686:Sspo UTSW 6 48460400 missense probably benign 0.00
R1707:Sspo UTSW 6 48477877 missense probably damaging 0.99
R1727:Sspo UTSW 6 48494848 missense probably damaging 1.00
R1822:Sspo UTSW 6 48492886 missense possibly damaging 0.75
R1831:Sspo UTSW 6 48489786 missense probably damaging 1.00
R1835:Sspo UTSW 6 48457340 missense probably damaging 0.97
R1862:Sspo UTSW 6 48491006 missense probably damaging 0.98
R1878:Sspo UTSW 6 48459366 missense possibly damaging 0.92
R1900:Sspo UTSW 6 48459350 missense probably benign 0.22
R1945:Sspo UTSW 6 48489773 missense possibly damaging 0.93
R1957:Sspo UTSW 6 48478273 missense probably damaging 0.99
R1990:Sspo UTSW 6 48451050 missense probably benign 0.00
R1996:Sspo UTSW 6 48475490 missense possibly damaging 0.50
R2049:Sspo UTSW 6 48460763 splice site probably benign
R2049:Sspo UTSW 6 48463531 missense probably benign 0.36
R2064:Sspo UTSW 6 48473662 missense probably damaging 0.99
R2072:Sspo UTSW 6 48473517 missense probably benign 0.01
R2096:Sspo UTSW 6 48461674 missense probably benign
R2106:Sspo UTSW 6 48466316 missense possibly damaging 0.96
R2230:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2230:Sspo UTSW 6 48500503 missense probably benign 0.11
R2232:Sspo UTSW 6 48448672 missense probably damaging 0.97
R2351:Sspo UTSW 6 48464869 missense probably damaging 1.00
R2423:Sspo UTSW 6 48454055 missense probably benign 0.00
R2508:Sspo UTSW 6 48464364 missense probably damaging 1.00
R3110:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3112:Sspo UTSW 6 48457600 missense probably damaging 1.00
R3413:Sspo UTSW 6 48480697 missense probably damaging 1.00
R3433:Sspo UTSW 6 48475951 splice site probably null
R3498:Sspo UTSW 6 48467980 missense possibly damaging 0.58
R3732:Sspo UTSW 6 48449930 missense probably damaging 1.00
R3816:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3818:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3819:Sspo UTSW 6 48481103 missense possibly damaging 0.77
R3838:Sspo UTSW 6 48480820 missense probably damaging 1.00
R3850:Sspo UTSW 6 48492490 missense probably damaging 1.00
R3880:Sspo UTSW 6 48494940 missense probably benign 0.38
R3893:Sspo UTSW 6 48476571 nonsense probably null
R4116:Sspo UTSW 6 48456994 missense probably damaging 0.99
R4179:Sspo UTSW 6 48498395 critical splice donor site probably null
R4180:Sspo UTSW 6 48498395 critical splice donor site probably null
R4207:Sspo UTSW 6 48478293 missense probably benign 0.00
R4210:Sspo UTSW 6 48464901 missense probably benign 0.00
R4223:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4224:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4225:Sspo UTSW 6 48451157 missense possibly damaging 0.54
R4229:Sspo UTSW 6 48490934 missense probably benign 0.00
R4230:Sspo UTSW 6 48490934 missense probably benign 0.00
R4363:Sspo UTSW 6 48498731 missense probably damaging 1.00
R4370:Sspo UTSW 6 48466348 missense probably null 0.14
R4407:Sspo UTSW 6 48460520 missense probably damaging 1.00
R4438:Sspo UTSW 6 48487353 missense probably damaging 1.00
R4454:Sspo UTSW 6 48487225 missense probably benign 0.05
R4455:Sspo UTSW 6 48465516 missense probably damaging 1.00
R4561:Sspo UTSW 6 48475534 splice site probably null
R4574:Sspo UTSW 6 48465523 missense probably damaging 1.00
R4578:Sspo UTSW 6 48463373 missense possibly damaging 0.58
R4653:Sspo UTSW 6 48478646 missense probably damaging 1.00
R4656:Sspo UTSW 6 48454076 missense possibly damaging 0.65
R4659:Sspo UTSW 6 48484213 missense probably damaging 1.00
R4664:Sspo UTSW 6 48473534 missense possibly damaging 0.82
R4685:Sspo UTSW 6 48492894 missense probably damaging 0.98
R4692:Sspo UTSW 6 48482687 missense probably damaging 1.00
R4703:Sspo UTSW 6 48500453 missense probably damaging 1.00
R4704:Sspo UTSW 6 48498704 missense probably damaging 1.00
R4738:Sspo UTSW 6 48478396 missense possibly damaging 0.78
R4766:Sspo UTSW 6 48470580 missense probably benign 0.04
R4771:Sspo UTSW 6 48460879 missense probably damaging 1.00
R4790:Sspo UTSW 6 48460771 missense probably benign 0.04
R4792:Sspo UTSW 6 48461585 missense probably benign 0.00
R4808:Sspo UTSW 6 48451161 missense probably damaging 1.00
R4812:Sspo UTSW 6 48490510 missense probably benign 0.00
R4883:Sspo UTSW 6 48460822 missense probably benign 0.00
R4906:Sspo UTSW 6 48465730 critical splice acceptor site probably null
R4934:Sspo UTSW 6 48465552 missense probably damaging 1.00
R4945:Sspo UTSW 6 48467087 splice site probably null
R4967:Sspo UTSW 6 48464605 missense probably damaging 0.97
R5016:Sspo UTSW 6 48452280 nonsense probably null
R5018:Sspo UTSW 6 48455700 missense probably damaging 1.00
R5034:Sspo UTSW 6 48480823 missense possibly damaging 0.93
R5044:Sspo UTSW 6 48466955 critical splice acceptor site probably null
R5055:Sspo UTSW 6 48464795 missense probably damaging 1.00
R5087:Sspo UTSW 6 48488471 missense possibly damaging 0.51
R5155:Sspo UTSW 6 48460474 missense probably benign 0.03
R5223:Sspo UTSW 6 48478324 missense probably damaging 1.00
R5249:Sspo UTSW 6 48493310 missense probably damaging 0.98
R5257:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5258:Sspo UTSW 6 48476494 missense probably damaging 1.00
R5276:Sspo UTSW 6 48490467 missense probably damaging 1.00
R5307:Sspo UTSW 6 48454850 missense probably damaging 0.99
R5341:Sspo UTSW 6 48459615 missense probably damaging 1.00
R5361:Sspo UTSW 6 48466313 missense probably benign 0.02
R5385:Sspo UTSW 6 48462253 missense probably benign 0.18
R5394:Sspo UTSW 6 48495260 missense possibly damaging 0.52
R5477:Sspo UTSW 6 48498393 missense possibly damaging 0.60
R5490:Sspo UTSW 6 48493280 missense probably benign 0.33
R5512:Sspo UTSW 6 48455671 missense probably damaging 0.97
R5518:Sspo UTSW 6 48496654 missense possibly damaging 0.92
R5530:Sspo UTSW 6 48465583 missense probably damaging 0.97
R5538:Sspo UTSW 6 48452178 missense probably damaging 0.99
R5590:Sspo UTSW 6 48474491 missense probably damaging 1.00
R5613:Sspo UTSW 6 48455044 missense possibly damaging 0.79
R5638:Sspo UTSW 6 48492891 missense possibly damaging 0.86
R5809:Sspo UTSW 6 48460045 missense possibly damaging 0.59
R5810:Sspo UTSW 6 48483898 missense probably benign 0.02
R5814:Sspo UTSW 6 48451884 missense probably damaging 1.00
R5915:Sspo UTSW 6 48464596 missense probably benign 0.00
R5915:Sspo UTSW 6 48491484 missense possibly damaging 0.83
R5979:Sspo UTSW 6 48463693 missense probably benign 0.20
R5996:Sspo UTSW 6 48494176 missense possibly damaging 0.87
R6012:Sspo UTSW 6 48451371 missense probably benign 0.00
R6025:Sspo UTSW 6 48486786 missense possibly damaging 0.83
R6120:Sspo UTSW 6 48465576 missense probably damaging 1.00
R6150:Sspo UTSW 6 48486379 missense probably benign 0.33
R6221:Sspo UTSW 6 48463705 missense probably damaging 1.00
R6261:Sspo UTSW 6 48462191 missense possibly damaging 0.75
R6312:Sspo UTSW 6 48457366 critical splice donor site probably null
R6372:Sspo UTSW 6 48472541 missense probably damaging 1.00
R6456:Sspo UTSW 6 48451806 missense probably benign 0.08
R6497:Sspo UTSW 6 48495208 missense possibly damaging 0.71
R6501:Sspo UTSW 6 48495212 missense possibly damaging 0.58
R6617:Sspo UTSW 6 48491046 missense possibly damaging 0.93
R6825:Sspo UTSW 6 48465525 missense probably benign 0.04
R6831:Sspo UTSW 6 48484833 missense possibly damaging 0.68
R6861:Sspo UTSW 6 48487955 missense probably benign 0.15
R6961:Sspo UTSW 6 48463877 missense probably benign 0.05
R6967:Sspo UTSW 6 48489794 missense probably benign 0.21
R7016:Sspo UTSW 6 48449164 missense probably damaging 1.00
R7035:Sspo UTSW 6 48449213 intron probably null
R7058:Sspo UTSW 6 48448582 missense probably damaging 1.00
R7072:Sspo UTSW 6 48454979 missense probably damaging 1.00
R7078:Sspo UTSW 6 48460379 missense probably damaging 1.00
R7082:Sspo UTSW 6 48478609 critical splice acceptor site probably null
R7120:Sspo UTSW 6 48465571 missense probably benign 0.05
R7127:Sspo UTSW 6 48449512 missense probably benign 0.02
R7146:Sspo UTSW 6 48501095 missense probably benign 0.15
R7220:Sspo UTSW 6 48476606 nonsense probably null
R7242:Sspo UTSW 6 48473952 missense probably benign
R7261:Sspo UTSW 6 48450077 missense possibly damaging 0.52
R7313:Sspo UTSW 6 48454828 missense probably damaging 1.00
R7313:Sspo UTSW 6 48473456 missense probably benign 0.04
R7323:Sspo UTSW 6 48461647 missense possibly damaging 0.93
X0060:Sspo UTSW 6 48466294 missense probably damaging 1.00
X0060:Sspo UTSW 6 48480794 missense probably damaging 1.00
X0063:Sspo UTSW 6 48497422 missense probably damaging 0.96
X0065:Sspo UTSW 6 48461684 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGACAAATAGTACCCTGTCCTGCCC -3'
(R):5'- TGAACCTGTGACTAGCCCCATCAAG -3'

Sequencing Primer
(F):5'- TGCCCTGACACCTTTCTTAG -3'
(R):5'- ATTTACCATTGCAGGCTCCG -3'
Posted On2014-07-16