Incidental Mutation 'R0243:Mcc'
ID215996
Institutional Source Beutler Lab
Gene Symbol Mcc
Ensembl Gene ENSMUSG00000071856
Gene Namemutated in colorectal cancers
SynonymsD18Ertd451e
MMRRC Submission 038481-MU
Accession Numbers

Ncbi RefSeq: NM_001085373.1, NM_001085374.1; MGI:96930

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0243 (G1)
Quality Score46
Status Validated
Chromosome18
Chromosomal Location44425060-44812182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44759299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 83 (T83S)
Ref Sequence ENSEMBL: ENSMUSP00000087318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089874]
Predicted Effect probably benign
Transcript: ENSMUST00000089874
AA Change: T83S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000087318
Gene: ENSMUSG00000071856
AA Change: T83S

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
EFh 24 52 1.36e-3 SMART
EFh 57 85 7.36e0 SMART
coiled coil region 196 308 N/A INTRINSIC
coiled coil region 395 466 N/A INTRINSIC
low complexity region 488 493 N/A INTRINSIC
low complexity region 512 517 N/A INTRINSIC
low complexity region 523 537 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 577 641 2.6e-32 PFAM
low complexity region 715 731 N/A INTRINSIC
coiled coil region 738 834 N/A INTRINSIC
low complexity region 853 863 N/A INTRINSIC
Pfam:MCC-bdg_PDZ 906 972 1.1e-21 PFAM
Meta Mutation Damage Score 0.1168 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.0%
Validation Efficiency 98% (148/151)
MGI Phenotype Strain: 3889488; 4335844
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate colorectal tumor suppressor gene that is thought to negatively regulate cell cycle progression. The orthologous gene in the mouse expresses a phosphoprotein associated with the plasma membrane and membrane organelles, and overexpression of the mouse protein inhibits entry into S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for hypomorphic or null mutations are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(29) : Targeted(2) Gene trapped(27)

Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T G 5: 63,898,463 Y181D probably benign Het
1110034G24Rik T C 2: 132,750,639 V202A probably benign Het
1700029H14Rik A G 8: 13,554,715 V196A possibly damaging Het
2410004B18Rik A G 3: 145,938,078 D7G probably damaging Het
2810474O19Rik T C 6: 149,326,241 Y262H probably damaging Het
Acap1 A G 11: 69,885,426 V249A probably damaging Het
Acat2 A T 17: 12,944,021 D313E probably benign Het
Actn4 T C 7: 28,905,398 T325A probably benign Het
Adamdec1 C T 14: 68,581,958 probably null Het
Adat2 A G 10: 13,553,293 T10A probably benign Het
Aff4 T A 11: 53,397,858 S400R possibly damaging Het
Agbl2 C T 2: 90,791,481 P104L possibly damaging Het
Alox12 G T 11: 70,242,716 T594K possibly damaging Het
Als2 C A 1: 59,215,387 K270N probably benign Het
Ankhd1 T A 18: 36,634,734 C1235S probably damaging Het
Ankrd24 T A 10: 81,634,944 I69N probably damaging Het
Aox4 G A 1: 58,213,076 V37I probably benign Het
Arfgap3 A G 15: 83,330,513 probably benign Het
Arhgef4 T A 1: 34,806,999 probably null Het
Asic1 C T 15: 99,698,617 probably benign Het
Atp8b5 A G 4: 43,366,057 N776S probably benign Het
Bbs7 A G 3: 36,605,734 I184T probably benign Het
Bbs9 A T 9: 22,514,001 H117L probably damaging Het
Bnip2 T C 9: 69,995,505 W10R probably damaging Het
Brd4 G T 17: 32,224,123 Q175K probably benign Het
Bysl A T 17: 47,606,896 V124E possibly damaging Het
Cadm3 A G 1: 173,346,573 probably benign Het
Cc2d2a T C 5: 43,696,638 probably benign Het
Ccdc134 G T 15: 82,140,946 E215D probably damaging Het
Celsr3 G T 9: 108,843,724 probably benign Het
Cntn5 T A 9: 9,781,775 D428V probably damaging Het
Cog1 A G 11: 113,656,995 probably benign Het
Col11a2 G T 17: 34,062,546 probably benign Het
Cyp4f13 G A 17: 32,924,969 probably benign Het
D3Ertd254e A G 3: 36,165,154 H442R possibly damaging Het
Dffb T A 4: 153,965,378 K343* probably null Het
Dnah9 T A 11: 65,911,852 I224F possibly damaging Het
Dolk A T 2: 30,286,019 C5S probably benign Het
Ebf1 A T 11: 44,869,088 probably benign Het
Elac1 A G 18: 73,742,363 L199P probably damaging Het
Elmod1 A C 9: 53,935,547 probably benign Het
Ep400 A C 5: 110,724,407 probably benign Het
F10 A T 8: 13,048,196 N133I probably damaging Het
Fasn A G 11: 120,815,315 Y1068H probably benign Het
Fbxo24 T C 5: 137,624,557 E12G probably damaging Het
Fer G T 17: 64,078,946 L304F probably benign Het
Filip1 A C 9: 79,819,003 L778R probably damaging Het
Fli1 A T 9: 32,423,981 I385N probably benign Het
Fpgs A T 2: 32,692,494 L89* probably null Het
Gab2 T G 7: 97,299,241 I346R probably damaging Het
Gm10764 G A 10: 87,290,979 G83R unknown Het
Gpr83 G T 9: 14,864,842 C153F possibly damaging Het
Gtf3c3 A G 1: 54,403,536 L783P possibly damaging Het
Gys2 A G 6: 142,472,668 probably benign Het
Heatr9 C T 11: 83,513,338 V378I possibly damaging Het
Helz A T 11: 107,637,914 Y920F possibly damaging Het
Inpp5f A T 7: 128,695,183 Q459L probably damaging Het
Ints12 T C 3: 133,109,045 S338P probably benign Het
Kif13a T C 13: 46,791,351 T925A probably benign Het
Kif1a C T 1: 93,042,093 V1051I probably damaging Het
Kif7 T A 7: 79,699,560 H1119L possibly damaging Het
Kmt2d C T 15: 98,850,137 probably benign Het
Krt90 C T 15: 101,562,675 G51S possibly damaging Het
Krtap31-2 A T 11: 99,936,746 I135F possibly damaging Het
Lrp2 T C 2: 69,428,630 E4572G probably benign Het
Mapk8ip1 T C 2: 92,385,944 E493G probably damaging Het
Matk T G 10: 81,258,492 L28V probably benign Het
Mtch1 A T 17: 29,340,106 M204K possibly damaging Het
Muc4 T G 16: 32,765,746 C2622G possibly damaging Het
Myo5a G A 9: 75,186,123 probably null Het
Myoz3 T C 18: 60,578,951 Y185C probably damaging Het
Nnmt A G 9: 48,592,138 V196A probably benign Het
Nr2f2 G C 7: 70,360,175 P52R probably damaging Het
Nup214 T A 2: 31,998,057 probably benign Het
Olfr1261 T A 2: 89,993,806 F138I probably benign Het
Olfr1383 T C 11: 49,523,912 L63P probably damaging Het
Olfr169 T G 16: 19,566,294 E196D probably damaging Het
Pank3 T C 11: 35,781,716 probably benign Het
Parm1 A T 5: 91,594,294 N174Y possibly damaging Het
Pcgf2 A T 11: 97,692,418 probably null Het
Pclo A T 5: 14,775,420 K4661M unknown Het
Pcsk7 A C 9: 45,916,059 S375R probably damaging Het
Pdzrn4 G T 15: 92,770,319 S784I possibly damaging Het
Pex6 T A 17: 46,723,737 probably null Het
Pi4ka C T 16: 17,297,635 V1384M probably benign Het
Polr3f T A 2: 144,536,275 probably benign Het
Ppp2r3a A T 9: 101,212,284 V280E probably damaging Het
Prdm14 C T 1: 13,122,448 G356R probably damaging Het
Prepl A G 17: 85,065,038 probably null Het
Primpol T C 8: 46,599,814 D154G probably damaging Het
Ptchd4 A C 17: 42,503,416 H736P probably damaging Het
Rab11fip1 A G 8: 27,152,225 S849P probably damaging Het
Rap1gap T A 4: 137,719,351 D405E probably damaging Het
Rbm26 T C 14: 105,131,938 T686A probably benign Het
Rint1 A G 5: 23,816,932 probably benign Het
Rnasek G T 11: 70,238,440 Y62* probably null Het
Rnf17 T G 14: 56,482,084 N930K possibly damaging Het
Sap130 A G 18: 31,680,681 probably benign Het
Sectm1b T A 11: 121,055,785 I95F probably damaging Het
Sema4f A T 6: 82,939,466 I53N possibly damaging Het
Siglec1 T C 2: 131,085,476 T137A probably damaging Het
Six5 A C 7: 19,097,022 probably null Het
Slc22a30 A T 19: 8,345,357 I345N probably benign Het
Slc25a27 A T 17: 43,643,627 M316K probably benign Het
Slc2a8 A T 2: 32,980,104 probably benign Het
Snx1 G A 9: 66,101,326 probably benign Het
Spag17 A G 3: 100,085,368 T1727A probably benign Het
Spata20 T C 11: 94,481,646 D633G probably benign Het
Spock1 C T 13: 57,436,109 probably null Het
Sra1 A T 18: 36,675,706 Y291* probably null Het
Sspo C A 6: 48,493,186 P4520T probably damaging Het
Stat4 A G 1: 52,011,857 N25S probably benign Het
Tbx18 A T 9: 87,715,516 probably benign Het
Tctex1d2 A G 16: 32,426,887 D118G probably damaging Het
Tep1 T A 14: 50,846,987 I187F probably damaging Het
Tfap2b A T 1: 19,234,123 I368F probably damaging Het
Tmtc1 A T 6: 148,246,837 L711Q probably damaging Het
Tmx3 T A 18: 90,538,489 probably benign Het
Tnc G T 4: 63,970,420 T1803K probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tpgs1 C T 10: 79,675,866 P281S probably benign Het
Trim45 A G 3: 100,929,844 R499G probably benign Het
Tulp3 A T 6: 128,325,958 Y299* probably null Het
Ube4a A T 9: 44,946,178 probably benign Het
Ubr3 T G 2: 69,951,405 S642R probably damaging Het
Vcpip1 A T 1: 9,747,206 Y317* probably null Het
Vmn1r115 G A 7: 20,844,402 T195I probably benign Het
Vmn1r226 G A 17: 20,687,577 V24I probably benign Het
Wdr41 C T 13: 95,017,406 A321V probably damaging Het
Wfdc5 T C 2: 164,178,835 N44D probably benign Het
Wnt7b C A 15: 85,558,902 probably null Het
Zfp108 T C 7: 24,261,783 S600P possibly damaging Het
Zfp385b A G 2: 77,415,728 probably null Het
Zfp395 T C 14: 65,386,480 S133P probably benign Het
Zfp407 T A 18: 84,558,711 M1426L probably damaging Het
Zfp641 T G 15: 98,289,127 N191T possibly damaging Het
Zfp687 T C 3: 95,011,553 S303G probably damaging Het
Zfp759 T A 13: 67,138,813 F143I possibly damaging Het
Zgrf1 G C 3: 127,615,446 E1690Q probably damaging Het
Other mutations in Mcc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Mcc APN 18 44449216 missense possibly damaging 0.93
IGL00981:Mcc APN 18 44449349 missense probably damaging 0.99
IGL00985:Mcc APN 18 44491239 missense probably damaging 1.00
IGL01674:Mcc APN 18 44491156 missense probably benign 0.10
IGL01862:Mcc APN 18 44759296 missense probably benign 0.00
IGL01935:Mcc APN 18 44519516 critical splice donor site probably null
IGL02168:Mcc APN 18 44449299 missense probably damaging 0.97
IGL02449:Mcc APN 18 44459958 missense probably benign 0.10
IGL02613:Mcc APN 18 44429954 missense probably damaging 1.00
IGL02709:Mcc APN 18 44445810 missense possibly damaging 0.73
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0009:Mcc UTSW 18 44445933 missense probably damaging 1.00
R0021:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0022:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0062:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0063:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0064:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0217:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0218:Mcc UTSW 18 44519516 critical splice donor site probably benign
R0373:Mcc UTSW 18 44475222 missense probably benign 0.01
R0564:Mcc UTSW 18 44468507 missense probably damaging 1.00
R0604:Mcc UTSW 18 44473756 missense probably damaging 1.00
R0691:Mcc UTSW 18 44445860 missense possibly damaging 0.67
R0965:Mcc UTSW 18 44724526 missense probably benign 0.41
R1015:Mcc UTSW 18 44724669 missense probably benign
R1186:Mcc UTSW 18 44759403 missense probably benign
R1215:Mcc UTSW 18 44468494 missense possibly damaging 0.93
R1878:Mcc UTSW 18 44468400 missense possibly damaging 0.69
R1990:Mcc UTSW 18 44491315 nonsense probably null
R1991:Mcc UTSW 18 44491315 nonsense probably null
R1992:Mcc UTSW 18 44491315 nonsense probably null
R2186:Mcc UTSW 18 44812078 missense possibly damaging 0.71
R2189:Mcc UTSW 18 44534230 missense possibly damaging 0.93
R2258:Mcc UTSW 18 44475136 missense probably damaging 1.00
R2267:Mcc UTSW 18 44519541 missense probably damaging 0.99
R2310:Mcc UTSW 18 44431366 missense probably damaging 1.00
R2343:Mcc UTSW 18 44459797 critical splice donor site probably null
R2377:Mcc UTSW 18 44519549 missense probably damaging 1.00
R3110:Mcc UTSW 18 44449263 missense probably damaging 1.00
R3112:Mcc UTSW 18 44449263 missense probably damaging 1.00
R4135:Mcc UTSW 18 44724640 missense probably benign 0.03
R4404:Mcc UTSW 18 44759298 missense probably benign
R4600:Mcc UTSW 18 44519520 missense probably damaging 1.00
R4606:Mcc UTSW 18 44468421 missense probably damaging 0.96
R4721:Mcc UTSW 18 44519556 missense probably damaging 1.00
R5858:Mcc UTSW 18 44510141 missense probably damaging 0.98
R5997:Mcc UTSW 18 44449321 missense probably damaging 1.00
R6482:Mcc UTSW 18 44445864 missense possibly damaging 0.94
R6502:Mcc UTSW 18 44468390 nonsense probably null
R6502:Mcc UTSW 18 44468391 missense probably damaging 1.00
R6518:Mcc UTSW 18 44661811 start gained probably benign
R6796:Mcc UTSW 18 44724560 missense probably benign
R6846:Mcc UTSW 18 44473640 missense possibly damaging 0.63
R6879:Mcc UTSW 18 44812112 missense unknown
R7147:Mcc UTSW 18 44493513 missense probably damaging 0.99
X0010:Mcc UTSW 18 44429957 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGGGGCATGGTCACATGACAC -3'
(R):5'- TGCCTAGAGAACCCAGATGAAGCAG -3'

Sequencing Primer
(F):5'- TGGTCACATGACACTTGATCAC -3'
(R):5'- atccacctgcctctgtttc -3'
Posted On2014-07-16