Incidental Mutation 'R0015:Klhdc8a'
ID216008
Institutional Source Beutler Lab
Gene Symbol Klhdc8a
Ensembl Gene ENSMUSG00000042115
Gene Namekelch domain containing 8A
SynonymsA630065K24Rik
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0015 (G1)
Quality Score72
Status Validated
Chromosome1
Chromosomal Location132298626-132307357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132303005 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 203 (T203A)
Ref Sequence ENSEMBL: ENSMUSP00000038297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046071]
Predicted Effect probably damaging
Transcript: ENSMUST00000046071
AA Change: T203A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038297
Gene: ENSMUSG00000042115
AA Change: T203A

DomainStartEndE-ValueType
Kelch 32 79 1.05e-11 SMART
Kelch 80 127 1.1e-1 SMART
Kelch 128 174 9.37e-2 SMART
Kelch 176 222 8.34e-6 SMART
Blast:Kelch 224 278 3e-9 BLAST
Kelch 279 326 6.82e-11 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a kelch domain-containing protein which is upregulated in cancer. Upregulated expression of the encoded protein may provide an alternative pathway for tumors to maintain aggressiveness in the absence of epidermal growth factor receptor dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Klhdc8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Klhdc8a APN 1 132303018 missense probably benign
IGL01106:Klhdc8a APN 1 132304700 missense probably benign 0.01
IGL02512:Klhdc8a APN 1 132303157 critical splice donor site probably null
R1442:Klhdc8a UTSW 1 132302647 missense possibly damaging 0.94
R1845:Klhdc8a UTSW 1 132303810 missense possibly damaging 0.80
R4857:Klhdc8a UTSW 1 132303105 missense probably damaging 1.00
R6357:Klhdc8a UTSW 1 132303153 missense probably damaging 0.99
R7226:Klhdc8a UTSW 1 132302606 missense probably damaging 1.00
R7427:Klhdc8a UTSW 1 132302967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGATAATCACATTGCCCTAGCC -3'
(R):5'- GCCGTAAGTTAGGAAGGATGCTCAG -3'

Sequencing Primer
(F):5'- TCTTTCAAAGGACTGAATAACAGAAG -3'
(R):5'- TGCCTGGATATGTAAGCAGCC -3'
Posted On2014-07-17