Incidental Mutation 'R0015:Mbd3l1'
ID216017
Institutional Source Beutler Lab
Gene Symbol Mbd3l1
Ensembl Gene ENSMUSG00000038691
Gene Namemethyl-CpG binding domain protein 3-like 1
SynonymsMbd3l, 1700070G05Rik, 1700095H13Rik
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0015 (G1)
Quality Score72
Status Validated
Chromosome9
Chromosomal Location18478359-18485298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18484858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000149425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069218] [ENSMUST00000213625] [ENSMUST00000215255]
Predicted Effect probably benign
Transcript: ENSMUST00000069218
AA Change: D93V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000063957
Gene: ENSMUSG00000038691
AA Change: D93V

DomainStartEndE-ValueType
Pfam:MBDa 3 74 8.5e-31 PFAM
Pfam:MBD_C 78 166 1.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213625
AA Change: D93V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000215255
AA Change: D93V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.1228 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to methyl-CpG-binding proteins but lacks the methyl-CpG binding domain. The protein is localized to discrete areas in the nucleus, and expression appears to be restricted to round spermatids, suggesting that the protein plays a role in the postmeiotic stages of male germ cell development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tead3 T C 17: 28,341,351 Y2C probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Mbd3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Mbd3l1 APN 9 18484727 missense probably damaging 1.00
R0011:Mbd3l1 UTSW 9 18484567 start gained probably benign
R1571:Mbd3l1 UTSW 9 18484651 missense probably damaging 1.00
R1737:Mbd3l1 UTSW 9 18484929 missense possibly damaging 0.46
R1762:Mbd3l1 UTSW 9 18485139 makesense probably null
R4981:Mbd3l1 UTSW 9 18484905 missense probably benign 0.00
R5171:Mbd3l1 UTSW 9 18485134 missense probably benign
R5244:Mbd3l1 UTSW 9 18484637 nonsense probably null
R6582:Mbd3l1 UTSW 9 18484728 missense probably benign 0.25
R7109:Mbd3l1 UTSW 9 18484914 missense possibly damaging 0.55
R7319:Mbd3l1 UTSW 9 18485121 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAGATGGGCAAGACTTCACAGAG -3'
(R):5'- TGTGTGCAATCAACGCCACTGC -3'

Sequencing Primer
(F):5'- GTTATACATTCAAGAGGCCAGTCAC -3'
(R):5'- TCAACGCCACTGCCAGTC -3'
Posted On2014-07-17