Incidental Mutation 'R0015:Rnf213'
ID 216021
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 038310-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0015 (G1)
Quality Score 50
Status Validated
Chromosome 11
Chromosomal Location 119283926-119378244 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 119332432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 2547 (D2547A)
Ref Sequence ENSEMBL: ENSMUSP00000115063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: D2548A

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: D2548A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000131035
AA Change: D2547A

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: D2547A

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.1093 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A130050O07Rik A G 1: 137,856,394 (GRCm39) Y23C unknown Het
Adcy3 G A 12: 4,245,260 (GRCm39) probably null Het
Aldh6a1 G A 12: 84,488,554 (GRCm39) L86F probably damaging Het
Arl10 G T 13: 54,723,770 (GRCm39) probably benign Het
Armc3 A G 2: 19,301,132 (GRCm39) probably null Het
Astn2 T G 4: 66,184,619 (GRCm39) probably null Het
Cacna1d G A 14: 29,836,928 (GRCm39) T804I probably benign Het
Ccny A C 18: 9,316,682 (GRCm39) probably benign Het
Cdh5 C T 8: 104,867,559 (GRCm39) T612I probably benign Het
Cfap58 A G 19: 48,017,539 (GRCm39) M800V probably benign Het
Clrn1 A T 3: 58,753,848 (GRCm39) I171K probably damaging Het
Cnp T A 11: 100,469,734 (GRCm39) probably null Het
Col12a1 T C 9: 79,558,667 (GRCm39) T1933A probably damaging Het
Cplane1 G A 15: 8,215,668 (GRCm39) R408H probably damaging Het
Cwf19l2 A G 9: 3,454,666 (GRCm39) S660G probably benign Het
Dync1i2 C A 2: 71,044,828 (GRCm39) R13S probably damaging Het
Eps8l1 A T 7: 4,480,556 (GRCm39) probably benign Het
Espn T C 4: 152,223,609 (GRCm39) T188A possibly damaging Het
F2 T C 2: 91,460,952 (GRCm39) E260G probably benign Het
Fat4 T A 3: 39,036,652 (GRCm39) S3435T probably damaging Het
Fchsd1 A G 18: 38,096,012 (GRCm39) C533R probably benign Het
Fstl5 G A 3: 76,229,498 (GRCm39) V100M probably damaging Het
Gls2 T G 10: 128,045,219 (GRCm39) L572R probably damaging Het
Gm20939 A T 17: 95,184,196 (GRCm39) E281D probably benign Het
Gpr35 T G 1: 92,910,954 (GRCm39) L222W probably damaging Het
Hsf5 C A 11: 87,548,161 (GRCm39) H615N probably benign Het
Id2 C T 12: 25,145,802 (GRCm39) D70N probably damaging Het
Ints2 T C 11: 86,140,113 (GRCm39) T240A probably damaging Het
Kcnn3 A C 3: 89,570,080 (GRCm39) D631A probably damaging Het
Klhdc8a A G 1: 132,230,743 (GRCm39) T203A probably damaging Het
Lama4 C T 10: 38,951,432 (GRCm39) T1059M possibly damaging Het
Lgals8 A G 13: 12,462,179 (GRCm39) L226P probably damaging Het
Lifr T A 15: 7,217,667 (GRCm39) probably null Het
Lonp1 T A 17: 56,925,406 (GRCm39) Q462L probably benign Het
Lypd1 A G 1: 125,838,175 (GRCm39) V48A possibly damaging Het
Mapkapk2 A G 1: 131,025,063 (GRCm39) I67T possibly damaging Het
Mbd3l1 A T 9: 18,396,154 (GRCm39) D93V probably benign Het
Mdh1b T C 1: 63,760,959 (GRCm39) probably benign Het
Myh7b C T 2: 155,464,206 (GRCm39) P569L probably damaging Het
Ncapd3 C A 9: 26,963,105 (GRCm39) A470E probably damaging Het
Ndrg2 A G 14: 52,147,902 (GRCm39) probably benign Het
Nprl2 A T 9: 107,421,618 (GRCm39) I209F probably damaging Het
Ntrk1 A G 3: 87,699,057 (GRCm39) probably benign Het
Olfm2 T C 9: 20,580,037 (GRCm39) E268G probably damaging Het
Or8b37 T A 9: 37,958,963 (GRCm39) Y148* probably null Het
Pcf11 T A 7: 92,307,525 (GRCm39) H881L probably benign Het
Pde10a A G 17: 9,196,029 (GRCm39) D640G probably damaging Het
Pde9a G A 17: 31,605,330 (GRCm39) probably null Het
Pianp G T 6: 124,978,503 (GRCm39) G236V probably damaging Het
Polr2g A G 19: 8,771,016 (GRCm39) I160T probably damaging Het
Ppp1r3a A G 6: 14,717,660 (GRCm39) S1085P possibly damaging Het
Pter G A 2: 13,005,811 (GRCm39) G328D probably damaging Het
Rad51 T A 2: 118,946,808 (GRCm39) M5K probably benign Het
Rbm43 T A 2: 51,815,679 (GRCm39) I181F probably benign Het
Rgs12 T C 5: 35,180,120 (GRCm39) probably benign Het
Slc20a2 C A 8: 23,025,361 (GRCm39) A21E probably damaging Het
Stab2 A G 10: 86,679,481 (GRCm39) S2503P probably benign Het
Sv2b A T 7: 74,775,389 (GRCm39) F479L probably damaging Het
Sybu T C 15: 44,536,896 (GRCm39) R349G probably damaging Het
Tead3 T C 17: 28,560,325 (GRCm39) Y2C probably damaging Het
Tnrc6c T A 11: 117,612,284 (GRCm39) N307K probably damaging Het
Ubxn11 C G 4: 133,843,336 (GRCm39) probably null Het
Ust T C 10: 8,205,829 (GRCm39) probably benign Het
Vmn2r116 T A 17: 23,620,823 (GRCm39) N852K probably benign Het
Zgrf1 T C 3: 127,349,046 (GRCm39) probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,340,169 (GRCm39) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,331,669 (GRCm39) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,338,063 (GRCm39) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,373,944 (GRCm39) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,334,126 (GRCm39) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,340,702 (GRCm39) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,327,178 (GRCm39) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,332,133 (GRCm39) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,333,092 (GRCm39) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,333,841 (GRCm39) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,307,283 (GRCm39) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,334,094 (GRCm39) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,309,135 (GRCm39) splice site probably benign
IGL02084:Rnf213 APN 11 119,336,499 (GRCm39) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,331,476 (GRCm39) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,371,733 (GRCm39) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,354,162 (GRCm39) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,327,628 (GRCm39) missense probably benign
IGL02588:Rnf213 APN 11 119,307,362 (GRCm39) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,331,615 (GRCm39) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,325,892 (GRCm39) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,318,336 (GRCm39) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,370,767 (GRCm39) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,336,452 (GRCm39) splice site probably benign
IGL03057:Rnf213 APN 11 119,331,913 (GRCm39) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,355,833 (GRCm39) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,364,998 (GRCm39) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,333,830 (GRCm39) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,312,294 (GRCm39) missense probably benign 0.34
attrition UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
defame UTSW 11 119,321,107 (GRCm39) nonsense probably null
Derogate UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
dinky UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,325,568 (GRCm39) missense
Impugn UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,316,895 (GRCm39) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
PIT4585001:Rnf213 UTSW 11 119,349,218 (GRCm39) missense
R0008:Rnf213 UTSW 11 119,355,878 (GRCm39) missense possibly damaging 0.82
R0041:Rnf213 UTSW 11 119,293,401 (GRCm39) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,305,413 (GRCm39) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,307,322 (GRCm39) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,370,426 (GRCm39) nonsense probably null
R0184:Rnf213 UTSW 11 119,305,347 (GRCm39) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,328,931 (GRCm39) nonsense probably null
R0365:Rnf213 UTSW 11 119,316,937 (GRCm39) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,338,083 (GRCm39) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,316,838 (GRCm39) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,333,946 (GRCm39) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,355,908 (GRCm39) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,334,106 (GRCm39) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,322,543 (GRCm39) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,332,660 (GRCm39) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,331,976 (GRCm39) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,331,894 (GRCm39) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,364,306 (GRCm39) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,313,921 (GRCm39) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,321,312 (GRCm39) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,305,396 (GRCm39) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,307,389 (GRCm39) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,343,407 (GRCm39) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,376,824 (GRCm39) splice site probably benign
R1104:Rnf213 UTSW 11 119,368,055 (GRCm39) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,326,809 (GRCm39) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,327,003 (GRCm39) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,326,831 (GRCm39) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,333,226 (GRCm39) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,328,576 (GRCm39) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,371,715 (GRCm39) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,332,714 (GRCm39) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,333,533 (GRCm39) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,332,665 (GRCm39) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,305,352 (GRCm39) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,327,437 (GRCm39) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,354,171 (GRCm39) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,333,405 (GRCm39) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,328,498 (GRCm39) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,331,047 (GRCm39) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,332,009 (GRCm39) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,340,955 (GRCm39) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,307,274 (GRCm39) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,322,511 (GRCm39) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,371,721 (GRCm39) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,331,933 (GRCm39) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,326,848 (GRCm39) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,352,744 (GRCm39) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,358,128 (GRCm39) nonsense probably null
R2109:Rnf213 UTSW 11 119,333,489 (GRCm39) nonsense probably null
R2115:Rnf213 UTSW 11 119,318,839 (GRCm39) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,341,027 (GRCm39) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,334,516 (GRCm39) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,306,019 (GRCm39) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,305,896 (GRCm39) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,350,835 (GRCm39) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,327,254 (GRCm39) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,305,430 (GRCm39) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,334,021 (GRCm39) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,350,764 (GRCm39) splice site probably null
R2698:Rnf213 UTSW 11 119,300,970 (GRCm39) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,359,718 (GRCm39) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,332,802 (GRCm39) nonsense probably null
R3808:Rnf213 UTSW 11 119,370,384 (GRCm39) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3856:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3973:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R4014:Rnf213 UTSW 11 119,336,555 (GRCm39) nonsense probably null
R4049:Rnf213 UTSW 11 119,373,274 (GRCm39) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,373,832 (GRCm39) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,300,308 (GRCm39) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,332,069 (GRCm39) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332:Rnf213 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,374,790 (GRCm39) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,370,496 (GRCm39) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,328,521 (GRCm39) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,331,951 (GRCm39) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,331,175 (GRCm39) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,336,571 (GRCm39) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,307,455 (GRCm39) missense possibly damaging 0.61
R4837:Rnf213 UTSW 11 119,333,589 (GRCm39) missense probably benign 0.00
R4894:Rnf213 UTSW 11 119,372,066 (GRCm39) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,318,983 (GRCm39) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,327,590 (GRCm39) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,301,633 (GRCm39) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,349,692 (GRCm39) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,331,642 (GRCm39) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,331,634 (GRCm39) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,299,846 (GRCm39) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,305,902 (GRCm39) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,324,325 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,731 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,455 (GRCm39) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,349,611 (GRCm39) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,325,512 (GRCm39) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,374,720 (GRCm39) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,327,121 (GRCm39) missense probably benign
R5861:Rnf213 UTSW 11 119,364,203 (GRCm39) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,312,195 (GRCm39) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,333,905 (GRCm39) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,376,836 (GRCm39) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,332,927 (GRCm39) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,307,385 (GRCm39) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,302,339 (GRCm39) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,302,296 (GRCm39) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,332,854 (GRCm39) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,326,825 (GRCm39) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,349,254 (GRCm39) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,305,374 (GRCm39) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,354,192 (GRCm39) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,367,904 (GRCm39) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,350,792 (GRCm39) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,343,513 (GRCm39) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,327,106 (GRCm39) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,370,746 (GRCm39) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,333,097 (GRCm39) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,333,062 (GRCm39) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,353,111 (GRCm39) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,339,664 (GRCm39) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,340,692 (GRCm39) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,370,481 (GRCm39) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,328,430 (GRCm39) splice site probably null
R7170:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7185:Rnf213 UTSW 11 119,315,024 (GRCm39) missense
R7239:Rnf213 UTSW 11 119,349,614 (GRCm39) missense
R7258:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7259:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7260:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7273:Rnf213 UTSW 11 119,322,582 (GRCm39) splice site probably null
R7282:Rnf213 UTSW 11 119,328,818 (GRCm39) missense
R7311:Rnf213 UTSW 11 119,307,373 (GRCm39) missense
R7352:Rnf213 UTSW 11 119,334,405 (GRCm39) missense
R7369:Rnf213 UTSW 11 119,321,294 (GRCm39) missense
R7410:Rnf213 UTSW 11 119,325,877 (GRCm39) missense
R7448:Rnf213 UTSW 11 119,372,117 (GRCm39) missense
R7561:Rnf213 UTSW 11 119,332,545 (GRCm39) missense
R7573:Rnf213 UTSW 11 119,349,310 (GRCm39) missense
R7615:Rnf213 UTSW 11 119,358,123 (GRCm39) missense
R7680:Rnf213 UTSW 11 119,370,382 (GRCm39) missense
R7739:Rnf213 UTSW 11 119,301,687 (GRCm39) missense
R7789:Rnf213 UTSW 11 119,361,045 (GRCm39) splice site probably null
R7806:Rnf213 UTSW 11 119,302,371 (GRCm39) missense
R8031:Rnf213 UTSW 11 119,321,107 (GRCm39) nonsense probably null
R8042:Rnf213 UTSW 11 119,332,480 (GRCm39) missense
R8053:Rnf213 UTSW 11 119,293,473 (GRCm39) missense
R8284:Rnf213 UTSW 11 119,318,909 (GRCm39) missense
R8301:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
R8325:Rnf213 UTSW 11 119,321,271 (GRCm39) missense
R8332:Rnf213 UTSW 11 119,374,524 (GRCm39) missense
R8443:Rnf213 UTSW 11 119,340,149 (GRCm39) missense
R8518:Rnf213 UTSW 11 119,353,043 (GRCm39) missense
R8531:Rnf213 UTSW 11 119,365,031 (GRCm39) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,349,563 (GRCm39) missense
R8675:Rnf213 UTSW 11 119,346,984 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,332,038 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,308,955 (GRCm39) missense
R8714:Rnf213 UTSW 11 119,359,720 (GRCm39) missense
R8802:Rnf213 UTSW 11 119,352,928 (GRCm39) missense
R8861:Rnf213 UTSW 11 119,333,062 (GRCm39) missense
R8886:Rnf213 UTSW 11 119,364,264 (GRCm39) missense
R8893:Rnf213 UTSW 11 119,333,868 (GRCm39) missense
R8937:Rnf213 UTSW 11 119,321,100 (GRCm39) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,305,250 (GRCm39) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,352,756 (GRCm39) missense
R8983:Rnf213 UTSW 11 119,321,175 (GRCm39) missense
R9043:Rnf213 UTSW 11 119,349,739 (GRCm39) missense
R9081:Rnf213 UTSW 11 119,357,062 (GRCm39) missense
R9132:Rnf213 UTSW 11 119,374,742 (GRCm39) missense
R9135:Rnf213 UTSW 11 119,299,573 (GRCm39) missense
R9146:Rnf213 UTSW 11 119,334,499 (GRCm39) missense
R9156:Rnf213 UTSW 11 119,331,574 (GRCm39) missense
R9183:Rnf213 UTSW 11 119,318,448 (GRCm39) missense
R9234:Rnf213 UTSW 11 119,340,943 (GRCm39) missense
R9275:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9278:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9296:Rnf213 UTSW 11 119,334,621 (GRCm39) splice site probably benign
R9350:Rnf213 UTSW 11 119,332,975 (GRCm39) missense
R9366:Rnf213 UTSW 11 119,327,057 (GRCm39) missense
R9413:Rnf213 UTSW 11 119,357,059 (GRCm39) missense
R9444:Rnf213 UTSW 11 119,325,623 (GRCm39) missense
R9464:Rnf213 UTSW 11 119,354,406 (GRCm39) missense
R9605:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R9649:Rnf213 UTSW 11 119,370,457 (GRCm39) missense
R9651:Rnf213 UTSW 11 119,331,238 (GRCm39) missense
R9664:Rnf213 UTSW 11 119,332,794 (GRCm39) missense
R9696:Rnf213 UTSW 11 119,359,806 (GRCm39) missense
R9710:Rnf213 UTSW 11 119,331,831 (GRCm39) missense
R9797:Rnf213 UTSW 11 119,333,365 (GRCm39) missense
S24628:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,332,650 (GRCm39) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,364,339 (GRCm39) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,331,289 (GRCm39) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,368,080 (GRCm39) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,373,824 (GRCm39) missense
Z1176:Rnf213 UTSW 11 119,332,236 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GCATATCATTGCTGCCTGCAACCC -3'
(R):5'- CAGTGCGGTAGGATGCTTTCTCTTC -3'

Sequencing Primer
(F):5'- TATCGGAAGCACTCCCAGG -3'
(R):5'- CTCTTCTAAAGAGGCATGGTAGC -3'
Posted On 2014-07-17