Incidental Mutation 'R0015:Tead3'
ID216025
Institutional Source Beutler Lab
Gene Symbol Tead3
Ensembl Gene ENSMUSG00000002249
Gene NameTEA domain family member 3
SynonymsDTEF-1, TEF-5, Tcf13r2, ETFR-1, TEAD-3
MMRRC Submission 038310-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0015 (G1)
Quality Score40
Status Validated
Chromosome17
Chromosomal Location28331671-28350805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28341351 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2 (Y2C)
Ref Sequence ENSEMBL: ENSMUSP00000115443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114799] [ENSMUST00000154873] [ENSMUST00000156862] [ENSMUST00000219703]
Predicted Effect probably damaging
Transcript: ENSMUST00000080572
AA Change: Y67C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079410
Gene: ENSMUSG00000002249
AA Change: Y67C

DomainStartEndE-ValueType
TEA 26 97 9.04e-52 SMART
low complexity region 124 139 N/A INTRINSIC
low complexity region 155 176 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 201 218 N/A INTRINSIC
PDB:3KYS|C 222 439 1e-121 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114799
AA Change: Y93C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110447
Gene: ENSMUSG00000002249
AA Change: Y93C

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
TEA 52 123 9.04e-52 SMART
low complexity region 150 165 N/A INTRINSIC
low complexity region 181 202 N/A INTRINSIC
low complexity region 208 222 N/A INTRINSIC
low complexity region 227 244 N/A INTRINSIC
PDB:3KYS|C 248 465 1e-120 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127212
Predicted Effect probably damaging
Transcript: ENSMUST00000154873
AA Change: Y2C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118582
Gene: ENSMUSG00000002249
AA Change: Y2C

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000156862
AA Change: Y2C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115443
Gene: ENSMUSG00000002249
AA Change: Y2C

DomainStartEndE-ValueType
Pfam:TEA 1 366 3.8e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219703
AA Change: Y67C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226172
Meta Mutation Damage Score 0.288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene product is a member of the transcriptional enhancer factor (TEF) family of transcription factors, which contain the TEA/ATTS DNA-binding domain. It is predominantly expressed in the placenta and thought to play a role in placental gene regulation and development. Alternative splicing, and alternate use of an upstream AUG translation initiation codon, and an in-frame downstream non-AUG (AUA) codon, results in 2 isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,186,184 R408H probably damaging Het
A130050O07Rik A G 1: 137,928,656 Y23C unknown Het
Adcy3 G A 12: 4,195,260 probably null Het
Aldh6a1 G A 12: 84,441,780 L86F probably damaging Het
Arl10 G T 13: 54,575,957 probably benign Het
Armc3 A G 2: 19,296,321 probably null Het
Astn2 T G 4: 66,266,382 probably null Het
Cacna1d G A 14: 30,114,971 T804I probably benign Het
Ccny A C 18: 9,316,682 probably benign Het
Cdh5 C T 8: 104,140,927 T612I probably benign Het
Cfap58 A G 19: 48,029,100 M800V probably benign Het
Clrn1 A T 3: 58,846,427 I171K probably damaging Het
Cnp T A 11: 100,578,908 probably null Het
Col12a1 T C 9: 79,651,385 T1933A probably damaging Het
Cwf19l2 A G 9: 3,454,666 S660G probably benign Het
Dync1i2 C A 2: 71,214,484 R13S probably damaging Het
Eps8l1 A T 7: 4,477,557 probably benign Het
Espn T C 4: 152,139,152 T188A possibly damaging Het
F2 T C 2: 91,630,607 E260G probably benign Het
Fat4 T A 3: 38,982,503 S3435T probably damaging Het
Fchsd1 A G 18: 37,962,959 C533R probably benign Het
Fstl5 G A 3: 76,322,191 V100M probably damaging Het
Gls2 T G 10: 128,209,350 L572R probably damaging Het
Gm20939 A T 17: 94,876,768 E281D probably benign Het
Gpr35 T G 1: 92,983,232 L222W probably damaging Het
Hsf5 C A 11: 87,657,335 H615N probably benign Het
Id2 C T 12: 25,095,803 D70N probably damaging Het
Ints2 T C 11: 86,249,287 T240A probably damaging Het
Kcnn3 A C 3: 89,662,773 D631A probably damaging Het
Klhdc8a A G 1: 132,303,005 T203A probably damaging Het
Lama4 C T 10: 39,075,436 T1059M possibly damaging Het
Lgals8 A G 13: 12,447,298 L226P probably damaging Het
Lifr T A 15: 7,188,186 probably null Het
Lonp1 T A 17: 56,618,406 Q462L probably benign Het
Lypd1 A G 1: 125,910,438 V48A possibly damaging Het
Mapkapk2 A G 1: 131,097,326 I67T possibly damaging Het
Mbd3l1 A T 9: 18,484,858 D93V probably benign Het
Mdh1b T C 1: 63,721,800 probably benign Het
Myh7b C T 2: 155,622,286 P569L probably damaging Het
Ncapd3 C A 9: 27,051,809 A470E probably damaging Het
Ndrg2 A G 14: 51,910,445 probably benign Het
Nprl2 A T 9: 107,544,419 I209F probably damaging Het
Ntrk1 A G 3: 87,791,750 probably benign Het
Olfm2 T C 9: 20,668,741 E268G probably damaging Het
Olfr884 T A 9: 38,047,667 Y148* probably null Het
Pcf11 T A 7: 92,658,317 H881L probably benign Het
Pde10a A G 17: 8,977,197 D640G probably damaging Het
Pde9a G A 17: 31,386,356 probably null Het
Pianp G T 6: 125,001,540 G236V probably damaging Het
Polr2g A G 19: 8,793,652 I160T probably damaging Het
Ppp1r3a A G 6: 14,717,661 S1085P possibly damaging Het
Pter G A 2: 13,001,000 G328D probably damaging Het
Rad51 T A 2: 119,116,327 M5K probably benign Het
Rbm43 T A 2: 51,925,667 I181F probably benign Het
Rgs12 T C 5: 35,022,776 probably benign Het
Rnf213 A C 11: 119,441,606 D2547A possibly damaging Het
Slc20a2 C A 8: 22,535,345 A21E probably damaging Het
Stab2 A G 10: 86,843,617 S2503P probably benign Het
Sv2b A T 7: 75,125,641 F479L probably damaging Het
Sybu T C 15: 44,673,500 R349G probably damaging Het
Tnrc6c T A 11: 117,721,458 N307K probably damaging Het
Ubxn11 C G 4: 134,116,025 probably null Het
Ust T C 10: 8,330,065 probably benign Het
Vmn2r116 T A 17: 23,401,849 N852K probably benign Het
Zgrf1 T C 3: 127,555,397 probably benign Het
Other mutations in Tead3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Tead3 APN 17 28332806 missense possibly damaging 0.91
IGL01752:Tead3 APN 17 28333594 missense probably damaging 1.00
IGL01760:Tead3 APN 17 28333081 missense probably benign 0.07
IGL02868:Tead3 APN 17 28333095 nonsense probably null
IGL02932:Tead3 APN 17 28341351 missense probably damaging 1.00
R0376:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R0383:Tead3 UTSW 17 28334698 splice site probably null
R1203:Tead3 UTSW 17 28341562 missense probably benign 0.06
R1699:Tead3 UTSW 17 28334724 missense possibly damaging 0.52
R2037:Tead3 UTSW 17 28336570 missense probably damaging 0.98
R2148:Tead3 UTSW 17 28333664 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28333615 missense probably damaging 1.00
R4871:Tead3 UTSW 17 28334988 missense probably benign 0.42
R5070:Tead3 UTSW 17 28341477 missense probably benign 0.06
R5557:Tead3 UTSW 17 28336270 intron probably benign
R5891:Tead3 UTSW 17 28341365 missense probably damaging 0.98
R5991:Tead3 UTSW 17 28334378 splice site probably null
R6335:Tead3 UTSW 17 28333325 missense probably damaging 1.00
R6999:Tead3 UTSW 17 28341532 missense probably benign 0.00
R7165:Tead3 UTSW 17 28333254 missense probably benign 0.00
X0066:Tead3 UTSW 17 28341427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTACTGACAGAGGCTCACTGGAC -3'
(R):5'- AAAAGCCTGCCCTAACCCTTGG -3'

Sequencing Primer
(F):5'- AGAGGCTCACTGGACTGACC -3'
(R):5'- TCTAGGCTCAGGCCATCCAG -3'
Posted On2014-07-17