Incidental Mutation 'R0145:Tnfaip2'
ID216048
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Nametumor necrosis factor, alpha-induced protein 2
SynonymsTnfaip2, tnfb94, Tnfip2
MMRRC Submission 038430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0145 (G1) of strain 722
Quality Score72
Status Validated
Chromosome12
Chromosomal Location111442469-111455018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111445858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 231 (V231E)
Ref Sequence ENSEMBL: ENSMUSP00000099806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000129467] [ENSMUST00000172783] [ENSMUST00000174298]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102745
AA Change: V231E

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: V231E

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109792
AA Change: V231E

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: V231E

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect probably benign
Transcript: ENSMUST00000129467
SMART Domains Protein: ENSMUSP00000133274
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.1016 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 93.7%
  • 20x: 82.1%
Validation Efficiency 96% (109/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,601,921 E64G probably damaging Het
1810043G02Rik T C 10: 77,983,556 S196P probably benign Het
4931408C20Rik A G 1: 26,687,332 M32T probably benign Het
Actr6 A T 10: 89,728,178 Y77* probably null Het
Aldoart1 A T 4: 72,851,339 S411T probably benign Het
Aqp1 C T 6: 55,346,687 R234C probably damaging Het
Arsb G A 13: 93,862,287 G368R possibly damaging Het
Asxl3 G A 18: 22,453,605 A151T probably damaging Het
Bcas3 T C 11: 85,359,610 probably benign Het
Bmpr2 AACACA AACA 1: 59,867,580 probably null Het
Bst1 A G 5: 43,819,072 Y49C probably damaging Het
Btrc T A 19: 45,423,173 L12Q probably damaging Het
Cd248 T C 19: 5,069,023 F300L possibly damaging Het
Cdk11b G T 4: 155,641,619 probably benign Het
Cfap44 A T 16: 44,468,372 D1495V probably damaging Het
Chil3 T A 3: 106,160,478 I124F probably damaging Het
Cnot2 A T 10: 116,517,368 S63T possibly damaging Het
Cox8a G T 19: 7,215,418 H61N probably benign Het
Cpne9 T C 6: 113,300,601 V427A probably damaging Het
Ctsll3 C A 13: 60,798,595 G301C probably damaging Het
Cubn T A 2: 13,306,432 D3094V probably damaging Het
Cyba A T 8: 122,427,238 M65K possibly damaging Het
Cyp4f39 T A 17: 32,486,960 S342T possibly damaging Het
Daam2 T C 17: 49,480,778 I436V probably benign Het
Daglb T C 5: 143,474,608 probably benign Het
Dnah7b T G 1: 46,223,178 L2067R probably damaging Het
Ep300 T C 15: 81,616,127 probably null Het
Esm1 A G 13: 113,216,696 N171D probably damaging Het
Fbxl2 T C 9: 113,985,325 E266G probably damaging Het
Ficd G T 5: 113,738,819 A352S probably damaging Het
H2-Q2 A G 17: 35,345,176 D302G probably benign Het
Hacd3 A T 9: 65,004,242 probably benign Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lct T C 1: 128,327,895 M137V probably benign Het
Lilr4b T G 10: 51,484,518 N176K probably benign Het
Macf1 T A 4: 123,387,397 H4340L probably damaging Het
Mcidas A G 13: 112,994,372 D77G probably damaging Het
Mmrn1 C A 6: 60,973,010 Q315K probably damaging Het
Mon2 C A 10: 123,013,512 L1294F possibly damaging Het
Muc5ac A G 7: 141,795,275 T483A possibly damaging Het
Nacc1 T C 8: 84,674,875 probably benign Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Ngef A G 1: 87,540,648 probably benign Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Ogfod3 A T 11: 121,195,070 probably benign Het
Olfr1104 A C 2: 87,021,790 Y251* probably null Het
Olfr767 A T 10: 129,079,363 V200E probably damaging Het
Parpbp T C 10: 88,093,009 Y523C possibly damaging Het
Pik3cg C A 12: 32,204,322 L555F probably benign Het
Pkp3 T G 7: 141,089,763 probably null Het
Pole G T 5: 110,324,425 R1518L probably damaging Het
Prkab1 T C 5: 116,018,085 probably benign Het
Prrc2a T C 17: 35,155,820 T1285A probably benign Het
Pus1 C A 5: 110,774,854 V222L probably benign Het
Rab11fip1 A G 8: 27,143,324 L1118P probably damaging Het
Ranbp2 T A 10: 58,480,046 I2196N probably damaging Het
Rims3 T C 4: 120,887,026 L151P probably damaging Het
Rnf130 A G 11: 50,071,219 D164G possibly damaging Het
Rps6ka2 C A 17: 7,262,186 L293I probably benign Het
Ruvbl1 A G 6: 88,484,459 T269A possibly damaging Het
Sema4a A T 3: 88,451,422 I10N probably damaging Het
Serpinb6e A T 13: 33,841,060 S83T probably benign Het
Slc12a9 C A 5: 137,315,288 W803L probably damaging Het
Slc3a2 A G 19: 8,708,073 S188P probably damaging Het
Slc7a13 G A 4: 19,818,782 probably benign Het
Spg20 A T 3: 55,127,671 K493* probably null Het
Sun1 T C 5: 139,241,411 V574A probably damaging Het
Supt6 A G 11: 78,208,236 V1603A probably benign Het
Tgm5 A G 2: 121,077,581 V38A possibly damaging Het
Tm6sf2 T C 8: 70,077,868 probably benign Het
Tube1 T A 10: 39,145,602 M281K possibly damaging Het
Tubgcp3 A G 8: 12,657,561 Y143H probably benign Het
Tyrp1 A G 4: 80,840,778 Y296C probably damaging Het
Utp4 A G 8: 106,894,669 N26S probably benign Het
Vgf T A 5: 137,031,482 probably benign Het
Zfat T C 15: 68,187,099 K196E possibly damaging Het
Zfp366 G T 13: 99,229,540 S403I probably damaging Het
Zfp462 G A 4: 55,010,529 G832R probably damaging Het
Zfp955a T A 17: 33,242,456 Q234L probably damaging Het
Zufsp T C 10: 33,943,713 T202A probably damaging Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111453549 missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111445619 missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111446101 missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111445810 missense probably benign 0.38
R0324:Tnfaip2 UTSW 12 111453459 missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111453507 missense probably benign 0.01
R0837:Tnfaip2 UTSW 12 111450707 missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111444969 missense probably damaging 1.00
R1366:Tnfaip2 UTSW 12 111449322 missense probably benign 0.00
R1988:Tnfaip2 UTSW 12 111449891 critical splice donor site probably null
R2109:Tnfaip2 UTSW 12 111448093 missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111446022 missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111451344 splice site probably benign
R4402:Tnfaip2 UTSW 12 111449851 missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111445248 missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111446029 missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111448460 intron probably benign
R6478:Tnfaip2 UTSW 12 111445663 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGGTCCTGAATGGGACATTG -3'
(R):5'- GCAGCAGCAAGTAGGTATCCCTTTC -3'

Sequencing Primer
(F):5'- CTGAATGGGACATTGGCCTC -3'
(R):5'- AGTAGGTATCCCTTTCACACAACTC -3'
Posted On2014-07-17