Incidental Mutation 'R0130:Rab38'
ID21608
Institutional Source Beutler Lab
Gene Symbol Rab38
Ensembl Gene ENSMUSG00000030559
Gene NameRAB38, member RAS oncogene family
Synonyms2310011F14Rik
MMRRC Submission 038415-MU
Accession Numbers

Genbank: NM_028238; MGI: 1919683

Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R0130 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location88430273-88491572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88450541 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 88 (I88N)
Ref Sequence ENSEMBL: ENSMUSP00000102877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107256] [ENSMUST00000208478]
Predicted Effect probably damaging
Transcript: ENSMUST00000107256
AA Change: I88N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102877
Gene: ENSMUSG00000030559
AA Change: I88N

DomainStartEndE-ValueType
RAB 10 180 8.9e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117390
Predicted Effect probably damaging
Transcript: ENSMUST00000208478
AA Change: I88N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Meta Mutation Damage Score 0.776 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation display oculocutaneous albinism, abnormal lung alveolar structure and aberrant pulmonary surfactant homeostasis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Spontaneous(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Rab38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Rab38 APN 7 88430532 missense probably damaging 1.00
fenrir UTSW 7 88450541 missense probably damaging 1.00
3370:Rab38 UTSW 7 88490651 missense probably benign 0.00
R1842:Rab38 UTSW 7 88450522 missense possibly damaging 0.88
R1893:Rab38 UTSW 7 88490716 missense probably benign
R4448:Rab38 UTSW 7 88490625 missense probably benign 0.01
R4635:Rab38 UTSW 7 88450646 missense probably damaging 0.99
R5555:Rab38 UTSW 7 88430487 missense probably damaging 0.99
R6415:Rab38 UTSW 7 88430540 missense possibly damaging 0.95
R6838:Rab38 UTSW 7 88450709 missense possibly damaging 0.94
R7383:Rab38 UTSW 7 88430429 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CGGCAAGAGCCTACAACTGTTGAAC -3'
(R):5'- TTGCAGAACTGGTCCATCTTGAGTC -3'

Posted On2013-04-11