Incidental Mutation 'R0130:Plekha7'
ID21610
Institutional Source Beutler Lab
Gene Symbol Plekha7
Ensembl Gene ENSMUSG00000045659
Gene Namepleckstrin homology domain containing, family A member 7
SynonymsA430081P20Rik
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R0130 (G1)
Quality Score105
Status Validated (trace)
Chromosome7
Chromosomal Location116123485-116308376 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116170704 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 276 (M276T)
Ref Sequence ENSEMBL: ENSMUSP00000138214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084664] [ENSMUST00000181981] [ENSMUST00000181998] [ENSMUST00000182487] [ENSMUST00000182511] [ENSMUST00000182834] [ENSMUST00000216517]
Predicted Effect probably damaging
Transcript: ENSMUST00000084664
AA Change: M40T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081714
Gene: ENSMUSG00000045659
AA Change: M40T

DomainStartEndE-ValueType
Blast:PH 1 47 2e-23 BLAST
SCOP:d1kz7a2 18 69 1e-5 SMART
low complexity region 100 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 322 351 N/A INTRINSIC
coiled coil region 461 500 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
low complexity region 677 693 N/A INTRINSIC
coiled coil region 828 856 N/A INTRINSIC
low complexity region 947 959 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181981
AA Change: M171T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138766
Gene: ENSMUSG00000045659
AA Change: M171T

DomainStartEndE-ValueType
PH 59 178 1.42e-18 SMART
low complexity region 231 243 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 453 482 N/A INTRINSIC
coiled coil region 592 631 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 808 824 N/A INTRINSIC
coiled coil region 959 987 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181998
AA Change: M276T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138575
Gene: ENSMUSG00000045659
AA Change: M276T

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
low complexity region 1183 1195 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182443
AA Change: M194T
Predicted Effect probably damaging
Transcript: ENSMUST00000182487
AA Change: M276T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138214
Gene: ENSMUSG00000045659
AA Change: M276T

DomainStartEndE-ValueType
WW 9 41 4.51e-2 SMART
WW 54 86 7.79e-6 SMART
PH 164 283 1.42e-18 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 377 390 N/A INTRINSIC
low complexity region 558 587 N/A INTRINSIC
coiled coil region 697 736 N/A INTRINSIC
coiled coil region 765 798 N/A INTRINSIC
low complexity region 913 929 N/A INTRINSIC
coiled coil region 1064 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182511
AA Change: M214T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138544
Gene: ENSMUSG00000045659
AA Change: M214T

DomainStartEndE-ValueType
PH 102 221 1.42e-18 SMART
low complexity region 274 286 N/A INTRINSIC
low complexity region 315 328 N/A INTRINSIC
low complexity region 496 525 N/A INTRINSIC
coiled coil region 635 674 N/A INTRINSIC
coiled coil region 703 736 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
coiled coil region 1002 1030 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182693
Predicted Effect possibly damaging
Transcript: ENSMUST00000182834
AA Change: M230T

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138257
Gene: ENSMUSG00000045659
AA Change: M230T

DomainStartEndE-ValueType
PH 118 237 1.42e-18 SMART
low complexity region 290 302 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
low complexity region 512 541 N/A INTRINSIC
coiled coil region 651 690 N/A INTRINSIC
coiled coil region 719 752 N/A INTRINSIC
low complexity region 867 883 N/A INTRINSIC
coiled coil region 1018 1046 N/A INTRINSIC
low complexity region 1137 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183308
Predicted Effect probably benign
Transcript: ENSMUST00000206662
Predicted Effect possibly damaging
Transcript: ENSMUST00000216517
AA Change: M276T

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show decreased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pld2 T G 11: 70,554,348 N591K probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Plekha7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Plekha7 APN 7 116135184 missense probably damaging 1.00
IGL01133:Plekha7 APN 7 116145241 splice site probably null
IGL01146:Plekha7 APN 7 116157473 splice site probably benign
IGL01307:Plekha7 APN 7 116145244 splice site probably benign
IGL02063:Plekha7 APN 7 116140701 missense possibly damaging 0.78
IGL02110:Plekha7 APN 7 116154628 splice site probably null
IGL02420:Plekha7 APN 7 116158234 missense probably damaging 1.00
IGL02660:Plekha7 APN 7 116157574 splice site probably benign
IGL02851:Plekha7 APN 7 116135178 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0066:Plekha7 UTSW 7 116157508 missense probably damaging 1.00
R0348:Plekha7 UTSW 7 116158020 missense probably damaging 1.00
R0595:Plekha7 UTSW 7 116144968 missense probably damaging 1.00
R0614:Plekha7 UTSW 7 116154645 nonsense probably null
R0732:Plekha7 UTSW 7 116145237 missense probably damaging 1.00
R1664:Plekha7 UTSW 7 116135034 splice site probably null
R1695:Plekha7 UTSW 7 116128685 missense probably damaging 1.00
R1794:Plekha7 UTSW 7 116140681 missense probably damaging 1.00
R1895:Plekha7 UTSW 7 116144974 missense probably damaging 1.00
R2153:Plekha7 UTSW 7 116175767 missense probably damaging 1.00
R3106:Plekha7 UTSW 7 116164404 missense probably benign 0.02
R3605:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3606:Plekha7 UTSW 7 116164242 missense possibly damaging 0.68
R3789:Plekha7 UTSW 7 116175734 missense probably damaging 1.00
R4584:Plekha7 UTSW 7 116237533 intron probably benign
R4750:Plekha7 UTSW 7 116137311 missense probably damaging 1.00
R4774:Plekha7 UTSW 7 116144943 missense probably damaging 1.00
R4810:Plekha7 UTSW 7 116144938 missense probably damaging 1.00
R4895:Plekha7 UTSW 7 116189391 unclassified probably null
R4925:Plekha7 UTSW 7 116158128 missense probably damaging 1.00
R5556:Plekha7 UTSW 7 116164149 missense probably benign 0.20
R5599:Plekha7 UTSW 7 116176882 splice site probably null
R5848:Plekha7 UTSW 7 116140399 missense probably damaging 1.00
R5928:Plekha7 UTSW 7 116128574 missense probably benign
R5941:Plekha7 UTSW 7 116124805 missense possibly damaging 0.56
R6351:Plekha7 UTSW 7 116176898 missense probably damaging 1.00
R6520:Plekha7 UTSW 7 116164482 missense probably benign 0.16
R6699:Plekha7 UTSW 7 116135175 missense probably damaging 1.00
R6781:Plekha7 UTSW 7 116157855 critical splice donor site probably null
R6843:Plekha7 UTSW 7 116143320 missense probably benign 0.45
R6977:Plekha7 UTSW 7 116135967 missense probably benign 0.01
R7048:Plekha7 UTSW 7 116148324 missense probably benign 0.07
R7269:Plekha7 UTSW 7 116181212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCACTTGGTCCAGTACAGACTTG -3'
(R):5'- ACTGGCCGACACTCTAGAAGCATC -3'

Sequencing Primer
(F):5'- CTTGAGAGAGCTGAGCATCCTAC -3'
(R):5'- CACTCTAGAAGCATCTAGAAGCGG -3'
Posted On2013-04-11