Incidental Mutation 'R0671:Kmt2c'
ID216145
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Namelysine (K)-specific methyltransferase 2C
SynonymsMll3, E330008K23Rik, HALR
MMRRC Submission 038856-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R0671 (G1)
Quality Score78
Status Validated
Chromosome5
Chromosomal Location25271798-25498783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25404365 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 254 (C254S)
Ref Sequence ENSEMBL: ENSMUSP00000133304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073] [ENSMUST00000173174]
Predicted Effect probably damaging
Transcript: ENSMUST00000045291
AA Change: C254S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: C254S

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172626
Predicted Effect probably damaging
Transcript: ENSMUST00000173073
AA Change: C254S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056
AA Change: C254S

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173174
AA Change: C254S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133304
Gene: ENSMUSG00000038056
AA Change: C254S

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 775 788 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 99% (125/126)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067K01Rik T C 8: 84,003,008 probably benign Het
4930430A15Rik A C 2: 111,204,137 V350G possibly damaging Het
A530064D06Rik G A 17: 48,166,656 T31I probably benign Het
Abca17 A G 17: 24,281,249 F1323L probably benign Het
Abcf3 T A 16: 20,550,487 N206K probably damaging Het
Adam10 A G 9: 70,765,941 probably benign Het
Adamtsl3 A T 7: 82,523,182 Q451L probably damaging Het
Adgrl3 T A 5: 81,560,905 I413N probably benign Het
Asb18 G T 1: 89,993,171 A128E probably damaging Het
Atf7ip2 T C 16: 10,241,879 S428P possibly damaging Het
Atp8b5 G T 4: 43,291,672 C15F possibly damaging Het
Bahcc1 A G 11: 120,287,320 E2235G probably damaging Het
Blnk G T 19: 40,937,667 S330* probably null Het
Bpnt1 T G 1: 185,356,611 N319K probably benign Het
Brip1 G A 11: 86,152,667 T357I possibly damaging Het
Cadm1 T A 9: 47,813,806 D288E probably benign Het
Calcoco2 A G 11: 96,107,528 V23A probably damaging Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Ccdc154 G T 17: 25,167,285 probably benign Het
Cdk12 T C 11: 98,230,109 probably benign Het
Clec4a3 A G 6: 122,954,034 probably null Het
Cpne2 T A 8: 94,548,342 probably benign Het
Cyfip1 T C 7: 55,923,962 probably null Het
Cyp26c1 A G 19: 37,686,561 H110R probably damaging Het
Cyp2j13 A G 4: 96,071,695 Y75H probably damaging Het
Defb43 T A 14: 63,011,838 V10D probably damaging Het
Dhx36 G A 3: 62,493,741 S368L possibly damaging Het
Dock6 G A 9: 21,804,627 probably benign Het
Elp2 T C 18: 24,612,442 probably benign Het
Emilin3 A G 2: 160,908,329 L453P probably damaging Het
Eml6 A T 11: 29,805,065 D903E probably benign Het
Ep300 T C 15: 81,616,134 probably benign Het
Ep400 G A 5: 110,688,196 T1899M unknown Het
Fancg A G 4: 43,002,998 S620P probably benign Het
Fbxo42 G A 4: 141,195,239 V239M probably damaging Het
Fermt2 T C 14: 45,469,319 D340G probably benign Het
Filip1 A T 9: 79,819,390 V649E probably damaging Het
Fut8 G A 12: 77,475,017 E477K probably damaging Het
Gbp3 G A 3: 142,565,390 G185D probably benign Het
Gclc G T 9: 77,786,798 D345Y probably damaging Het
Gkn2 A G 6: 87,375,818 D43G possibly damaging Het
Gm960 A G 19: 4,626,188 S639P probably damaging Het
Gnptab A G 10: 88,443,304 probably benign Het
Greb1l C T 18: 10,474,303 T206I probably damaging Het
Grk4 A G 5: 34,748,267 N452S probably benign Het
Hcn2 G C 10: 79,734,232 probably null Het
Hpn T C 7: 31,109,160 K76E possibly damaging Het
Hspg2 A G 4: 137,553,280 D3268G probably damaging Het
Immt A T 6: 71,871,557 Q467L possibly damaging Het
Kalrn T C 16: 34,116,408 S1636G probably benign Het
Kcnh8 T A 17: 52,978,113 L1037* probably null Het
Klhl33 T C 14: 50,892,394 T548A probably damaging Het
Klri2 T C 6: 129,740,208 I71V probably benign Het
Lama3 T C 18: 12,477,590 I1170T possibly damaging Het
Med12l A G 3: 59,264,929 Q1702R probably damaging Het
Mga A T 2: 119,919,910 probably null Het
Mis18a A T 16: 90,720,673 I172K possibly damaging Het
Mrgpre T C 7: 143,781,517 D83G probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mrpl39 T C 16: 84,734,394 probably benign Het
Mrrf C T 2: 36,153,698 A149V probably benign Het
Mycbp2 A T 14: 103,194,588 M2338K possibly damaging Het
Myo18b T C 5: 112,692,766 Q2387R probably benign Het
N4bp2 T C 5: 65,807,437 I943T probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Ncoa1 A T 12: 4,249,758 probably null Het
Ncor2 C T 5: 125,049,387 A136T probably benign Het
Olfr311 T A 11: 58,841,855 I247N possibly damaging Het
Olfr483 C A 7: 108,104,156 Y282* probably null Het
Olfr539 A G 7: 140,667,677 D123G probably damaging Het
Olfr887 T A 9: 38,085,127 M97K possibly damaging Het
Opa1 T C 16: 29,602,207 probably benign Het
Pcdhb4 T C 18: 37,307,742 M35T probably benign Het
Per3 T C 4: 151,028,831 I347V probably benign Het
Pex13 G A 11: 23,665,831 P5L possibly damaging Het
Phkb T A 8: 85,875,693 W38R probably damaging Het
Plekhf1 A T 7: 38,221,402 D247E probably benign Het
Plxnb2 A G 15: 89,157,981 S1607P probably benign Het
Plxnc1 T A 10: 94,799,332 H1344L possibly damaging Het
Ptk7 T G 17: 46,590,312 N196H possibly damaging Het
Rab27a G T 9: 73,075,433 D7Y probably damaging Het
Rars2 T A 4: 34,630,505 C82* probably null Het
Rccd1 A T 7: 80,320,217 probably benign Het
Riiad1 T C 3: 94,472,239 I56V possibly damaging Het
Rnase4 A G 14: 51,105,050 E77G probably damaging Het
Rnf126 A T 10: 79,761,607 I157N possibly damaging Het
Rnf207 T C 4: 152,307,468 R623G probably benign Het
Rpusd1 T G 17: 25,728,524 F62V possibly damaging Het
Rxfp1 T C 3: 79,663,293 probably null Het
Scfd1 A T 12: 51,412,628 Q324L probably benign Het
Skint3 G T 4: 112,255,777 E195* probably null Het
Slc7a10 A T 7: 35,197,333 T165S probably benign Het
Smagp A G 15: 100,621,852 I97T probably damaging Het
Sostdc1 A G 12: 36,317,341 H172R probably damaging Het
Spast A G 17: 74,339,451 probably benign Het
Sspo G T 6: 48,490,391 probably benign Het
Ston2 C T 12: 91,740,466 probably null Het
Tas2r103 T G 6: 133,036,350 E251A probably benign Het
Tbc1d2b A T 9: 90,222,505 probably benign Het
Telo2 G A 17: 25,113,165 P143L probably benign Het
Tgfbi A T 13: 56,638,726 Y674F probably null Het
Tha1 T A 11: 117,873,157 probably benign Het
Timp4 T A 6: 115,249,853 S110C probably damaging Het
Tlr6 T C 5: 64,954,592 K324R probably benign Het
Tnip3 A G 6: 65,597,363 E137G probably damaging Het
Trak1 T C 9: 121,448,955 probably null Het
Trim47 A G 11: 116,108,352 S233P probably benign Het
Tspoap1 A T 11: 87,762,809 E155V probably damaging Het
Tsta3 A G 15: 75,928,958 V27A possibly damaging Het
Uggt1 A T 1: 36,155,128 L1343Q probably damaging Het
Utp14b T C 1: 78,664,735 S117P probably benign Het
Vmn1r124 A T 7: 21,260,511 V36D probably damaging Het
Wdr27 T C 17: 14,928,396 T112A probably benign Het
Wdr90 T C 17: 25,846,393 T1630A probably benign Het
Zfp352 A G 4: 90,223,919 T99A probably benign Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25281261 missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25293161 missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25311051 missense probably benign 0.00
IGL00811:Kmt2c APN 5 25374533 missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25409171 missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25377161 missense probably benign 0.08
IGL00959:Kmt2c APN 5 25276229 missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25302701 unclassified probably benign
IGL01146:Kmt2c APN 5 25308512 missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25284399 missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25409308 missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25352244 missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25329441 splice site probably benign
IGL01530:Kmt2c APN 5 25313500 missense probably benign 0.08
IGL01550:Kmt2c APN 5 25281276 missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25273666 makesense probably null
IGL01598:Kmt2c APN 5 25354771 missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25354811 missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25310670 missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25300098 missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25313400 missense probably benign
IGL01784:Kmt2c APN 5 25313526 missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25290804 missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25310596 missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25395455 missense probably benign 0.05
IGL02072:Kmt2c APN 5 25405432 missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25311343 missense probably benign 0.18
IGL02303:Kmt2c APN 5 25310157 missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25373020 missense probably benign
IGL02578:Kmt2c APN 5 25366200 intron probably benign
IGL02811:Kmt2c APN 5 25315028 nonsense probably null
IGL02943:Kmt2c APN 5 25290823 missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25284172 missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25310352 missense probably benign
IGL03076:Kmt2c APN 5 25299151 nonsense probably null
IGL03088:Kmt2c APN 5 25299804 missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25315361 missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25315766 small insertion probably benign
FR4976:Kmt2c UTSW 5 25315763 small insertion probably benign
R0313:Kmt2c UTSW 5 25344930 missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25309708 missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25375957 missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25315664 missense probably benign
R0453:Kmt2c UTSW 5 25354747 missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25299252 missense probably benign
R0619:Kmt2c UTSW 5 25298916 missense probably benign 0.21
R0736:Kmt2c UTSW 5 25295434 missense probably benign
R0745:Kmt2c UTSW 5 25359698 splice site probably null
R0760:Kmt2c UTSW 5 25353317 missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25310895 missense probably benign 0.00
R0882:Kmt2c UTSW 5 25295607 missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25351270 splice site probably benign
R0942:Kmt2c UTSW 5 25315303 missense probably benign 0.10
R1110:Kmt2c UTSW 5 25314362 missense probably benign 0.01
R1137:Kmt2c UTSW 5 25310983 missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25351153 missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25405454 missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25314515 missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25314878 missense probably benign 0.01
R1611:Kmt2c UTSW 5 25359311 critical splice donor site probably null
R1617:Kmt2c UTSW 5 25375927 missense probably benign 0.01
R1720:Kmt2c UTSW 5 25299184 missense probably benign 0.05
R1723:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25315005 missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25290527 missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25372974 missense probably benign 0.02
R1809:Kmt2c UTSW 5 25284192 missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25373436 missense probably benign 0.45
R1895:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1946:Kmt2c UTSW 5 25315154 missense probably benign 0.34
R1989:Kmt2c UTSW 5 25498544 missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25329040 missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25285079 missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25352280 missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25354717 missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25309824 missense probably benign 0.01
R2186:Kmt2c UTSW 5 25287112 missense probably damaging 1.00
R2395:Kmt2c UTSW 5 25315152 missense probably benign
R2983:Kmt2c UTSW 5 25315757 small deletion probably benign
R3109:Kmt2c UTSW 5 25275735 missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25299479 missense probably benign 0.02
R3738:Kmt2c UTSW 5 25405383 missense probably benign 0.41
R3809:Kmt2c UTSW 5 25409138 missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25287713 missense probably benign
R4107:Kmt2c UTSW 5 25298920 missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25347359 critical splice donor site probably null
R4376:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4377:Kmt2c UTSW 5 25315326 missense probably benign 0.00
R4383:Kmt2c UTSW 5 25351062 missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25314877 missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25310212 missense probably benign
R4461:Kmt2c UTSW 5 25299876 missense probably benign 0.00
R4519:Kmt2c UTSW 5 25363477 missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25300174 missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25300315 missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25354384 missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25366177 missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25314027 nonsense probably null
R4781:Kmt2c UTSW 5 25443825 missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25315113 missense probably benign
R4855:Kmt2c UTSW 5 25314557 missense probably benign 0.00
R4919:Kmt2c UTSW 5 25314395 missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25310872 missense probably benign 0.00
R4983:Kmt2c UTSW 5 25295511 missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25299712 nonsense probably null
R5033:Kmt2c UTSW 5 25314708 missense probably benign 0.03
R5093:Kmt2c UTSW 5 25409207 missense probably benign 0.17
R5125:Kmt2c UTSW 5 25284381 missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25315473 missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25314594 missense probably benign 0.01
R5396:Kmt2c UTSW 5 25294734 splice site probably null
R5415:Kmt2c UTSW 5 25314701 missense probably benign 0.21
R5523:Kmt2c UTSW 5 25299339 missense probably benign 0.00
R5554:Kmt2c UTSW 5 25294610 missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25314017 missense probably benign 0.16
R5762:Kmt2c UTSW 5 25310457 missense probably benign 0.01
R5819:Kmt2c UTSW 5 25409132 critical splice donor site probably null
R5838:Kmt2c UTSW 5 25284471 missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25347469 missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25330803 missense probably benign 0.15
R5988:Kmt2c UTSW 5 25311120 missense probably benign 0.02
R5999:Kmt2c UTSW 5 25284205 missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25299129 missense probably benign
R6254:Kmt2c UTSW 5 25349874 missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25443818 critical splice donor site probably null
R6329:Kmt2c UTSW 5 25315602 missense probably benign 0.01
R6347:Kmt2c UTSW 5 25310835 missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25309636 missense probably null 0.99
R6379:Kmt2c UTSW 5 25359341 missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25323789 missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25298928 missense probably benign
R6733:Kmt2c UTSW 5 25409293 missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25275739 splice site probably null
R6816:Kmt2c UTSW 5 25405532 splice site probably null
R6862:Kmt2c UTSW 5 25310517 missense probably damaging 1.00
X0024:Kmt2c UTSW 5 25405485 missense probably benign 0.26
X0027:Kmt2c UTSW 5 25330887 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGGATTCTATCCTCAGCACCGTACA -3'
(R):5'- CCCCAAGTCACAGTAAGGGTCAGT -3'

Sequencing Primer
(F):5'- gaaagaagaggaggaggaagg -3'
(R):5'- cccattagccttgaactcataac -3'
Posted On2014-07-25