Incidental Mutation 'R0130:Pld2'
ID21618
Institutional Source Beutler Lab
Gene Symbol Pld2
Ensembl Gene ENSMUSG00000020828
Gene Namephospholipase D2
Synonyms
MMRRC Submission 038415-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R0130 (G1)
Quality Score166
Status Not validated
Chromosome11
Chromosomal Location70540064-70558110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70554348 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 591 (N591K)
Ref Sequence ENSEMBL: ENSMUSP00000104197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018429] [ENSMUST00000108557]
Predicted Effect probably benign
Transcript: ENSMUST00000018429
AA Change: N591K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018429
Gene: ENSMUSG00000020828
AA Change: N591K

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 751 778 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108557
AA Change: N591K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104197
Gene: ENSMUSG00000020828
AA Change: N591K

DomainStartEndE-ValueType
PX 64 192 2.12e-20 SMART
PH 203 313 4.75e-6 SMART
PLDc 437 464 8.44e-4 SMART
PLDc 762 789 4.12e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179806
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.7%
  • 10x: 93.4%
  • 20x: 80.2%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene is a member of the phospholipase D (PLD) superfamily. The encoded protein catalyzes the hydrolysis of phosphatidylcholine to phosphatidic acid and choline. Phosphatidic acid is an essential intracellular lipid second messenger for many signaling pathways and has been implicated in a variety of physiological processes including cytoskeletal organization and cell proliferation. A similar gene in human may also function as a guanine nucleotide exchange factor (GEF) for the small GTPase Rac2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out fail to exhibit Abeta42 suppression of LTP and show altered brain phosphatidic acid levels. Mice homozygous for a different knock-out allele show normal platelet function, hemostasis and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A T 17: 84,686,666 Y37F probably damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Apol7c A G 15: 77,526,362 I128T possibly damaging Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Arfip2 A G 7: 105,638,998 probably benign Het
Atp5j2 A T 5: 145,188,182 probably benign Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
Cd22 A G 7: 30,869,964 Y402H possibly damaging Het
Cd248 A G 19: 5,069,962 T613A probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Cenpc1 A T 5: 86,046,546 D120E probably benign Het
Chd3 T A 11: 69,359,830 H691L probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
Ctnnd2 A T 15: 30,921,913 E895V probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dync1h1 C A 12: 110,618,674 T837K probably benign Het
Eif2ak3 C A 6: 70,881,732 probably benign Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Fat2 T A 11: 55,252,118 M4302L probably benign Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Gde1 A T 7: 118,695,060 F63L probably benign Het
Gjc3 A G 5: 137,957,940 S28P probably benign Het
Gm10250 G A 15: 5,120,991 probably null Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Map3k11 T C 19: 5,690,815 L190P probably damaging Het
Mki67 T A 7: 135,696,459 Q2282L probably damaging Het
Mthfd2 T A 6: 83,309,008 I272F probably damaging Het
Myom1 A T 17: 71,045,755 D358V probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Nebl T C 2: 17,390,926 probably benign Het
Nlrp2 T A 7: 5,322,418 N14Y possibly damaging Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr304 T C 7: 86,386,306 Y118C probably damaging Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Plekha7 A G 7: 116,170,704 M276T probably damaging Het
Prss39 T A 1: 34,502,200 probably benign Het
Prtg A G 9: 72,809,716 Y113C probably damaging Het
Rab38 T A 7: 88,450,541 I88N probably damaging Het
Rbfox2 A G 15: 77,091,857 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sec14l1 A T 11: 117,156,407 K637I possibly damaging Het
Sh2b1 A T 7: 126,471,448 D360E possibly damaging Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Tectb G T 19: 55,181,961 K81N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Tiam1 T C 16: 89,897,754 M272V probably benign Het
Trav13-3 T A 14: 53,729,776 noncoding transcript Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Other mutations in Pld2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Pld2 APN 11 70551180 nonsense probably null
IGL01094:Pld2 APN 11 70541306 missense probably damaging 0.99
IGL01696:Pld2 APN 11 70542780 missense probably damaging 1.00
IGL02165:Pld2 APN 11 70555677 missense probably damaging 1.00
IGL02477:Pld2 APN 11 70540925 missense possibly damaging 0.60
IGL02712:Pld2 APN 11 70557079 missense probably benign 0.44
IGL03013:Pld2 APN 11 70541177 missense probably damaging 1.00
R0117:Pld2 UTSW 11 70557388 missense probably benign 0.19
R0508:Pld2 UTSW 11 70552542 missense probably damaging 0.98
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0973:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R0974:Pld2 UTSW 11 70557081 missense probably damaging 1.00
R1907:Pld2 UTSW 11 70544184 missense probably damaging 0.99
R2087:Pld2 UTSW 11 70542960 missense probably damaging 1.00
R2181:Pld2 UTSW 11 70542989 missense possibly damaging 0.70
R2379:Pld2 UTSW 11 70554314 missense probably benign 0.01
R3772:Pld2 UTSW 11 70544123 unclassified probably benign
R3949:Pld2 UTSW 11 70553354 missense probably benign
R4028:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4029:Pld2 UTSW 11 70554905 missense probably damaging 1.00
R4160:Pld2 UTSW 11 70541427 missense probably damaging 1.00
R4428:Pld2 UTSW 11 70541334 missense probably damaging 1.00
R4595:Pld2 UTSW 11 70542020 missense probably damaging 1.00
R4945:Pld2 UTSW 11 70555698 missense probably damaging 1.00
R5280:Pld2 UTSW 11 70552759 missense probably damaging 1.00
R5659:Pld2 UTSW 11 70557561 makesense probably null
R5773:Pld2 UTSW 11 70555932 missense probably damaging 1.00
R5900:Pld2 UTSW 11 70556062 critical splice donor site probably null
R6249:Pld2 UTSW 11 70555370 missense probably damaging 1.00
R6362:Pld2 UTSW 11 70554675 missense probably damaging 1.00
R6746:Pld2 UTSW 11 70541107 missense probably damaging 0.96
R6922:Pld2 UTSW 11 70553447 missense probably benign 0.02
R7213:Pld2 UTSW 11 70553372 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCACCAAGGTGCTGAGTCCTTCC -3'
(R):5'- AATGTCCCTGCTGACCATCGATCC -3'

Sequencing Primer
(F):5'- TCCGAAGGGCCTggagg -3'
(R):5'- GCTGATCAGGACTGTCACC -3'
Posted On2013-04-11