Incidental Mutation 'R0466:Ppp2r5e'
ID216209
Institutional Source Beutler Lab
Gene Symbol Ppp2r5e
Ensembl Gene ENSMUSG00000021051
Gene Nameprotein phosphatase 2, regulatory subunit B', epsilon
SynonymsB56beta, protein phosphatase 2A subunit beta, 4633401M22Rik
MMRRC Submission 038666-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0466 (G1)
Quality Score72
Status Validated
Chromosome12
Chromosomal Location75450881-75596245 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 75462442 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021447] [ENSMUST00000218012] [ENSMUST00000220035]
Predicted Effect probably benign
Transcript: ENSMUST00000021447
SMART Domains Protein: ENSMUSP00000021447
Gene: ENSMUSG00000021051

DomainStartEndE-ValueType
low complexity region 18 41 N/A INTRINSIC
Pfam:B56 48 453 3.2e-195 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218012
Predicted Effect probably benign
Transcript: ENSMUST00000220035
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an epsilon isoform of the regulatory subunit B56 subfamily. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik T C 11: 58,612,505 probably benign Het
4933412E24Rik T C 15: 60,015,472 Y373C probably benign Het
Abca12 T G 1: 71,302,663 Q1046H probably damaging Het
Adgrv1 A G 13: 81,566,296 F956S probably benign Het
Alk A G 17: 71,905,157 V797A possibly damaging Het
Armc4 T A 18: 7,286,758 I158F probably benign Het
Ascl2 A G 7: 142,968,480 L77P probably benign Het
Aspm A T 1: 139,477,901 I1509F probably damaging Het
AY358078 A T 14: 51,805,632 Y259F unknown Het
Cbs G A 17: 31,616,152 A450V probably benign Het
Cdh11 T A 8: 102,670,058 Q213L possibly damaging Het
Cdh26 C T 2: 178,481,632 R675C possibly damaging Het
Cfap126 T C 1: 171,126,200 I113T probably damaging Het
Clk4 A G 11: 51,267,328 D53G possibly damaging Het
Dab1 T C 4: 104,720,550 L272P probably benign Het
Dmtf1 A T 5: 9,132,454 probably null Het
Dph5 A C 3: 115,928,710 D279A probably benign Het
Fbxw19 T A 9: 109,478,649 T461S probably benign Het
G3bp1 T C 11: 55,498,626 F383L probably damaging Het
Gcg T C 2: 62,476,938 D93G probably damaging Het
Gmps A G 3: 63,993,944 T395A probably damaging Het
H2-Ob A G 17: 34,242,659 D124G probably damaging Het
Itga8 G T 2: 12,232,886 A341E probably damaging Het
Itih3 A G 14: 30,912,874 probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Kif2c C T 4: 117,172,292 R215Q possibly damaging Het
Letm1 A C 5: 33,761,730 probably benign Het
Mmp3 A G 9: 7,450,165 D299G probably damaging Het
Myh8 G T 11: 67,298,579 A1194S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Nfib A C 4: 82,498,538 Y87D probably damaging Het
Nlrp4a T C 7: 26,462,620 probably benign Het
Nsmce1 A T 7: 125,472,236 probably benign Het
Olfr834 T G 9: 18,988,255 V89G probably benign Het
Olfr845 A T 9: 19,339,179 T240S probably damaging Het
Patj C A 4: 98,688,156 Q1193K probably damaging Het
Pcdhb5 G A 18: 37,322,543 V659M probably damaging Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pmis2 T C 7: 30,671,392 I46V probably benign Het
Prom2 A G 2: 127,528,789 F825S probably damaging Het
Rab11fip2 G A 19: 59,906,243 A524V possibly damaging Het
Rb1cc1 A C 1: 6,263,267 probably null Het
Rwdd3 G C 3: 121,159,019 Q180E possibly damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgcg A T 14: 61,221,686 C265S probably damaging Het
Slc16a3 T C 11: 120,958,052 S445P possibly damaging Het
Slc22a3 G A 17: 12,458,493 Q263* probably null Het
Sorcs3 A G 19: 48,748,319 T694A probably benign Het
Tbc1d15 T C 10: 115,219,172 K322E probably damaging Het
Tecta G T 9: 42,373,073 F905L probably benign Het
Tmeff1 A G 4: 48,636,853 I184V possibly damaging Het
Ttf1 A G 2: 29,065,407 H261R possibly damaging Het
Ttll6 T A 11: 96,145,591 L349M probably damaging Het
Ubac2 G A 14: 121,973,619 V134M probably damaging Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r25 T G 6: 123,852,049 I89L probably benign Het
Vmn2r6 A C 3: 64,556,302 F370L probably damaging Het
Vps13b T A 15: 35,445,602 Y412* probably null Het
Zfp142 A G 1: 74,585,411 S85P possibly damaging Het
Zfp516 G A 18: 82,957,454 probably null Het
Other mutations in Ppp2r5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02602:Ppp2r5e APN 12 75493439 missense probably damaging 1.00
IGL03398:Ppp2r5e APN 12 75462405 missense possibly damaging 0.73
IGL03402:Ppp2r5e APN 12 75464893 missense probably damaging 0.99
R0129:Ppp2r5e UTSW 12 75462390 missense probably damaging 1.00
R0894:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1452:Ppp2r5e UTSW 12 75469536 splice site probably benign
R1551:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1614:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1693:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1844:Ppp2r5e UTSW 12 75469766 missense possibly damaging 0.81
R1864:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1908:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1909:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R1933:Ppp2r5e UTSW 12 75469567 missense probably damaging 1.00
R2181:Ppp2r5e UTSW 12 75462324 missense probably benign 0.08
R3084:Ppp2r5e UTSW 12 75468616 missense probably benign 0.23
R4212:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4213:Ppp2r5e UTSW 12 75469551 missense probably damaging 1.00
R4680:Ppp2r5e UTSW 12 75469759 missense probably damaging 1.00
R4761:Ppp2r5e UTSW 12 75593261 missense possibly damaging 0.92
R5147:Ppp2r5e UTSW 12 75469770 missense probably damaging 0.96
R5262:Ppp2r5e UTSW 12 75593271 missense probably damaging 1.00
R5304:Ppp2r5e UTSW 12 75515685 missense possibly damaging 0.75
R5429:Ppp2r5e UTSW 12 75453763 missense probably damaging 0.99
R5439:Ppp2r5e UTSW 12 75493476 missense probably benign
R7225:Ppp2r5e UTSW 12 75468579 missense probably damaging 0.96
R7453:Ppp2r5e UTSW 12 75462342 missense probably damaging 0.99
R7558:Ppp2r5e UTSW 12 75464992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACAGGTCAGAAAGCCTCTCAAG -3'
(R):5'- ACTGATGAACCACCTGGCAACTTC -3'

Sequencing Primer
(F):5'- GTCAGAAAGCCTCTCAAGTAAAAAG -3'
(R):5'- GGCAACTTCTTGGAAGATCATAAATC -3'
Posted On2014-07-31