Incidental Mutation 'R0709:Dlg5'
ID216236
Institutional Source Beutler Lab
Gene Symbol Dlg5
Ensembl Gene ENSMUSG00000021782
Gene Namediscs large MAGUK scaffold protein 5
Synonyms4933429D20Rik
MMRRC Submission 038892-MU
Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0709 (G1)
Quality Score52
Status Validated
Chromosome14
Chromosomal Location24133953-24245920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24146255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1625 (V1625M)
Ref Sequence ENSEMBL: ENSMUSP00000087879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]
Predicted Effect probably damaging
Transcript: ENSMUST00000042009
AA Change: V1276M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782
AA Change: V1276M

DomainStartEndE-ValueType
coiled coil region 20 247 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
PDZ 279 356 2.02e-10 SMART
PDZ 364 447 9.5e-16 SMART
low complexity region 510 517 N/A INTRINSIC
low complexity region 692 711 N/A INTRINSIC
low complexity region 903 918 N/A INTRINSIC
PDZ 1009 1080 2.1e-17 SMART
PDZ 1164 1236 2.97e-8 SMART
SH3 1250 1314 3.73e-7 SMART
low complexity region 1338 1358 N/A INTRINSIC
GuKc 1375 1561 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073687
AA Change: V1602M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: V1602M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
Pfam:Takusan 104 191 1.4e-27 PFAM
coiled coil region 308 578 N/A INTRINSIC
low complexity region 592 605 N/A INTRINSIC
PDZ 610 687 2.02e-10 SMART
PDZ 695 773 1.25e-15 SMART
low complexity region 836 843 N/A INTRINSIC
low complexity region 1018 1037 N/A INTRINSIC
low complexity region 1229 1244 N/A INTRINSIC
PDZ 1335 1406 2.1e-17 SMART
PDZ 1490 1562 2.97e-8 SMART
SH3 1576 1640 3.73e-7 SMART
low complexity region 1664 1684 N/A INTRINSIC
GuKc 1701 1887 5.43e-53 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000090398
AA Change: V1625M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: V1625M

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 22 36 N/A INTRINSIC
low complexity region 44 66 N/A INTRINSIC
low complexity region 109 123 N/A INTRINSIC
Pfam:Takusan 128 213 6e-33 PFAM
coiled coil region 331 601 N/A INTRINSIC
low complexity region 615 628 N/A INTRINSIC
PDZ 633 710 2.02e-10 SMART
PDZ 718 796 1.25e-15 SMART
low complexity region 859 866 N/A INTRINSIC
low complexity region 1041 1060 N/A INTRINSIC
low complexity region 1252 1267 N/A INTRINSIC
PDZ 1358 1429 2.1e-17 SMART
PDZ 1513 1585 2.97e-8 SMART
SH3 1599 1663 3.73e-7 SMART
low complexity region 1687 1707 N/A INTRINSIC
GuKc 1724 1910 5.43e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164638
Predicted Effect probably benign
Transcript: ENSMUST00000166007
SMART Domains Protein: ENSMUSP00000127054
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
low complexity region 41 61 N/A INTRINSIC
GuKc 78 224 6.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170112
SMART Domains Protein: ENSMUSP00000128735
Gene: ENSMUSG00000021782

DomainStartEndE-ValueType
Blast:PDZ 2 45 4e-25 BLAST
PDB:1UIT|A 2 50 7e-30 PDB
SCOP:d1ky9a1 2 51 7e-7 SMART
Meta Mutation Damage Score 0.448 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.8%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]
Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630010A05Rik A T 16: 14,618,494 D137V probably damaging Het
Aar2 C T 2: 156,567,010 P378L probably damaging Het
Abcc5 A T 16: 20,376,592 H718Q possibly damaging Het
Ace G T 11: 105,981,538 L319F probably damaging Het
Angpt4 C A 2: 151,934,514 P321T possibly damaging Het
Atrip T C 9: 109,067,103 N282S probably benign Het
AW554918 A C 18: 25,463,654 S525R probably damaging Het
Casc4 T A 2: 121,867,425 V74E probably damaging Het
Ccdc136 T A 6: 29,414,970 I644N possibly damaging Het
Ccdc178 A G 18: 22,067,662 Y413H probably damaging Het
Ccdc7b A G 8: 129,136,646 H223R probably benign Het
Cd109 T C 9: 78,671,978 V634A possibly damaging Het
Col7a1 T A 9: 108,961,548 probably benign Het
Copb2 A T 9: 98,563,167 probably benign Het
Csrnp3 C T 2: 66,022,563 S445L probably damaging Het
Cxcl13 G T 5: 95,958,671 C34F probably damaging Het
Dars2 T C 1: 161,046,928 E397G probably benign Het
Dnah12 T G 14: 26,884,265 probably benign Het
Eif4a1 C A 11: 69,670,252 A76S probably damaging Het
Fam162b T A 10: 51,587,251 I107L probably damaging Het
Fbxo30 G T 10: 11,291,313 C593F possibly damaging Het
Fut9 A G 4: 25,620,359 F152L probably damaging Het
Galnt2 G A 8: 124,343,346 G534D probably benign Het
Gm973 C T 1: 59,558,234 probably benign Het
Gprc5a T A 6: 135,078,950 S132T probably damaging Het
Hk3 G A 13: 55,014,730 R47C probably damaging Het
Hrnr A T 3: 93,332,508 Q3351L unknown Het
Icam1 T A 9: 21,019,127 F92L probably damaging Het
Ifi213 C T 1: 173,589,800 V349I possibly damaging Het
Il12rb2 T C 6: 67,298,904 probably benign Het
Irx3 A G 8: 91,799,420 V487A possibly damaging Het
Kalrn A G 16: 34,035,554 V204A probably damaging Het
Krt16 T C 11: 100,246,454 probably benign Het
Loxhd1 G A 18: 77,404,969 V1369I probably benign Het
Med13 T A 11: 86,319,596 K573N possibly damaging Het
Mnat1 A G 12: 73,188,188 R204G possibly damaging Het
Myt1l A T 12: 29,827,733 D461V unknown Het
Nek6 T A 2: 38,557,846 S41T probably damaging Het
Nudt22 T C 19: 6,993,506 E232G probably damaging Het
Numbl C A 7: 27,273,990 F192L probably damaging Het
Olfr1202 C T 2: 88,817,882 T237I probably benign Het
Olfr834 T A 9: 18,988,126 I46K probably damaging Het
P2rx4 T C 5: 122,714,404 V47A probably damaging Het
Phka1 T A X: 102,586,104 I478F probably damaging Het
Pkn2 G A 3: 142,830,520 T200I probably damaging Het
Plcg1 T A 2: 160,751,778 probably null Het
Polg2 C T 11: 106,768,413 G425R probably damaging Het
Ptprm G T 17: 66,944,332 probably null Het
Reg1 G A 6: 78,428,118 R108H possibly damaging Het
Slc19a2 T A 1: 164,256,798 F86I probably damaging Het
Slc26a11 T C 11: 119,374,777 L372P probably damaging Het
Slc2a4 C T 11: 69,946,159 V28M possibly damaging Het
Snap29 A G 16: 17,406,148 N9S probably damaging Het
Snd1 C G 6: 28,545,470 probably benign Het
Sorcs3 G A 19: 48,487,406 A235T probably benign Het
Sp100 T A 1: 85,694,281 N362K probably damaging Het
Sqor A T 2: 122,799,855 I32F probably benign Het
Stx6 C T 1: 155,193,294 R189C probably damaging Het
Tchp T C 5: 114,717,453 I298T probably damaging Het
Themis A G 10: 28,761,574 I225V probably benign Het
Timm50 A T 7: 28,306,941 V245E probably damaging Het
Tnxb A G 17: 34,689,354 E1327G probably damaging Het
Tpp1 C T 7: 105,749,607 R205H probably benign Het
Tradd T C 8: 105,260,644 E10G possibly damaging Het
Trim43a G A 9: 88,582,146 E37K probably benign Het
Ttn T C 2: 76,899,403 probably benign Het
Ttr A T 18: 20,669,977 probably null Het
Ubp1 A G 9: 113,944,931 Y66C probably damaging Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r104 A T 17: 20,042,904 N98K probably damaging Het
Yipf5 A G 18: 40,207,772 S176P probably benign Het
Zpbp2 C T 11: 98,553,937 T97I probably damaging Het
Other mutations in Dlg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Dlg5 APN 14 24191161 missense probably damaging 0.99
IGL00164:Dlg5 APN 14 24158464 missense possibly damaging 0.89
IGL00767:Dlg5 APN 14 24165285 missense probably damaging 1.00
IGL01284:Dlg5 APN 14 24146197 missense probably damaging 1.00
IGL01328:Dlg5 APN 14 24202351 missense probably damaging 0.98
IGL01532:Dlg5 APN 14 24158592 missense probably benign
IGL01621:Dlg5 APN 14 24148221 missense probably damaging 1.00
IGL01649:Dlg5 APN 14 24138691 missense probably damaging 1.00
IGL01733:Dlg5 APN 14 24170449 missense probably damaging 1.00
IGL02048:Dlg5 APN 14 24172203 missense possibly damaging 0.87
IGL02103:Dlg5 APN 14 24144346 missense probably damaging 1.00
IGL02138:Dlg5 APN 14 24158351 missense probably benign
IGL02146:Dlg5 APN 14 24202361 missense probably damaging 0.99
IGL02392:Dlg5 APN 14 24150209 missense probably damaging 1.00
IGL02427:Dlg5 APN 14 24166207 missense probably damaging 1.00
IGL02643:Dlg5 APN 14 24191182 missense probably damaging 1.00
IGL02649:Dlg5 APN 14 24146251 missense probably damaging 0.96
IGL02933:Dlg5 APN 14 24158499 missense probably benign 0.06
IGL02965:Dlg5 APN 14 24172023 missense probably damaging 1.00
IGL02988:Dlg5 APN 14 24166255 missense probably damaging 1.00
IGL03351:Dlg5 APN 14 24170454 missense probably benign 0.03
R0123:Dlg5 UTSW 14 24147206 missense probably benign
R0131:Dlg5 UTSW 14 24138649 missense probably damaging 1.00
R0920:Dlg5 UTSW 14 24176397 missense probably damaging 1.00
R0924:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0930:Dlg5 UTSW 14 24135577 missense probably damaging 1.00
R0981:Dlg5 UTSW 14 24154631 missense probably damaging 1.00
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1402:Dlg5 UTSW 14 24176608 missense probably benign 0.06
R1438:Dlg5 UTSW 14 24154605 missense possibly damaging 0.94
R1449:Dlg5 UTSW 14 24135643 missense possibly damaging 0.82
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1465:Dlg5 UTSW 14 24154696 splice site probably null
R1543:Dlg5 UTSW 14 24144448 missense probably damaging 1.00
R1824:Dlg5 UTSW 14 24149444 missense probably benign 0.28
R1899:Dlg5 UTSW 14 24148300 missense probably damaging 1.00
R1920:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1921:Dlg5 UTSW 14 24176571 missense probably damaging 1.00
R1951:Dlg5 UTSW 14 24156469 splice site probably benign
R1968:Dlg5 UTSW 14 24164119 nonsense probably null
R2049:Dlg5 UTSW 14 24154647 missense probably damaging 1.00
R2070:Dlg5 UTSW 14 24136635 missense probably damaging 1.00
R2117:Dlg5 UTSW 14 24177758 nonsense probably null
R2139:Dlg5 UTSW 14 24170544 missense probably damaging 1.00
R2153:Dlg5 UTSW 14 24137157 missense probably damaging 1.00
R2283:Dlg5 UTSW 14 24158663 missense probably benign 0.00
R2293:Dlg5 UTSW 14 24158112 missense probably benign
R2356:Dlg5 UTSW 14 24170428 critical splice donor site probably null
R2362:Dlg5 UTSW 14 24158687 missense probably benign 0.04
R2513:Dlg5 UTSW 14 24164525 missense probably damaging 1.00
R3084:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3086:Dlg5 UTSW 14 24166190 missense probably damaging 1.00
R3750:Dlg5 UTSW 14 24165260 missense probably damaging 1.00
R3780:Dlg5 UTSW 14 24190310 unclassified probably benign
R3782:Dlg5 UTSW 14 24190310 unclassified probably benign
R3828:Dlg5 UTSW 14 24146158 missense probably damaging 0.99
R4079:Dlg5 UTSW 14 24148260 missense possibly damaging 0.94
R4393:Dlg5 UTSW 14 24177989 critical splice acceptor site probably null
R4615:Dlg5 UTSW 14 24158168 missense probably damaging 1.00
R4664:Dlg5 UTSW 14 24137181 missense possibly damaging 0.90
R4712:Dlg5 UTSW 14 24177983 missense possibly damaging 0.94
R4796:Dlg5 UTSW 14 24144383 missense probably damaging 1.00
R4801:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4802:Dlg5 UTSW 14 24154689 missense probably damaging 1.00
R4946:Dlg5 UTSW 14 24154361 missense probably damaging 0.99
R5022:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5023:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5057:Dlg5 UTSW 14 24136622 missense probably damaging 1.00
R5234:Dlg5 UTSW 14 24192862 missense probably damaging 0.98
R5561:Dlg5 UTSW 14 24177792 missense probably benign 0.03
R5567:Dlg5 UTSW 14 24192913 nonsense probably null
R5570:Dlg5 UTSW 14 24192913 nonsense probably null
R5640:Dlg5 UTSW 14 24170461 missense probably damaging 1.00
R5646:Dlg5 UTSW 14 24158699 missense probably damaging 1.00
R5711:Dlg5 UTSW 14 24150648 missense probably damaging 1.00
R5810:Dlg5 UTSW 14 24146254 missense probably damaging 0.99
R5900:Dlg5 UTSW 14 24149447 missense probably damaging 1.00
R5964:Dlg5 UTSW 14 24164089 missense probably benign
R6190:Dlg5 UTSW 14 24190438 missense probably damaging 0.99
R6240:Dlg5 UTSW 14 24149528 intron probably null
R6276:Dlg5 UTSW 14 24164568 missense probably damaging 1.00
R6339:Dlg5 UTSW 14 24158060 missense probably damaging 1.00
R6508:Dlg5 UTSW 14 24138706 missense probably benign 0.45
R6527:Dlg5 UTSW 14 24190448 missense possibly damaging 0.73
R6593:Dlg5 UTSW 14 24150652 missense probably benign 0.01
R6687:Dlg5 UTSW 14 24190373 missense probably damaging 1.00
R6965:Dlg5 UTSW 14 24149430 missense probably damaging 1.00
R7051:Dlg5 UTSW 14 24146195 missense possibly damaging 0.93
R7075:Dlg5 UTSW 14 24177797 missense possibly damaging 0.49
R7149:Dlg5 UTSW 14 24190424 missense probably benign 0.00
R7182:Dlg5 UTSW 14 24244856 missense
R7203:Dlg5 UTSW 14 24138655 missense probably damaging 1.00
R7216:Dlg5 UTSW 14 24136638 nonsense probably null
R7359:Dlg5 UTSW 14 24164547 missense probably damaging 1.00
R7466:Dlg5 UTSW 14 24245212 missense probably damaging 1.00
R7485:Dlg5 UTSW 14 24148322 missense probably benign
R7485:Dlg5 UTSW 14 24177839 missense probably damaging 0.98
YA93:Dlg5 UTSW 14 24155133 unclassified probably benign
Z1088:Dlg5 UTSW 14 24158094 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTATGCATCCCGATTCGCCG -3'
(R):5'- GGGCTTCAACTTCAGAAACAGGCAG -3'

Sequencing Primer
(F):5'- TGTAAACTGCCTACTGCGAG -3'
(R):5'- CATAGAGGAAGTCTTTCCCCAGTG -3'
Posted On2014-07-31