Incidental Mutation 'R1942:Rapgef6'
ID216310
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 039960-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54657263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 753 (I753V)
Ref Sequence ENSEMBL: ENSMUSP00000099804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
Predicted Effect probably benign
Transcript: ENSMUST00000094536
AA Change: I468V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: I468V

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101206
AA Change: I753V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: I753V

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102743
AA Change: I753V

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: I753V

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108894
AA Change: I468V

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: I468V

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175600
Predicted Effect probably benign
Transcript: ENSMUST00000207429
AA Change: I758V

PolyPhen 2 Score 0.282 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2566:Rapgef6 UTSW 11 54687711 missense possibly damaging 0.66
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGAGTACTCTTCCTACTTGTTAAC -3'
(R):5'- TTTGGAGAACTGGTCCGGAAG -3'

Sequencing Primer
(F):5'- GTCCCAGATCCTACATGATGG -3'
(R):5'- AGAACTGGTCCGGAAGTCTTCTC -3'
Posted On2014-08-01