Incidental Mutation 'R1942:Itsn2'
ID216313
Institutional Source Beutler Lab
Gene Symbol Itsn2
Ensembl Gene ENSMUSG00000020640
Gene Nameintersectin 2
SynonymsSh3d1B, Eh domain, SH3 domain regulator of endocytosis 2, Ese2, Sh3p18
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4592638-4713962 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 4639670 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 581 (L581*)
Ref Sequence ENSEMBL: ENSMUSP00000151896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062580] [ENSMUST00000219007] [ENSMUST00000220311]
Predicted Effect probably null
Transcript: ENSMUST00000062580
AA Change: L581*
SMART Domains Protein: ENSMUSP00000052758
Gene: ENSMUSG00000020640
AA Change: L581*

DomainStartEndE-ValueType
EH 15 109 8.44e-41 SMART
EFh 58 86 7.18e-3 SMART
low complexity region 156 169 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
EH 238 333 4.06e-43 SMART
EFh 282 310 6.16e-2 SMART
coiled coil region 366 462 N/A INTRINSIC
coiled coil region 516 556 N/A INTRINSIC
coiled coil region 580 715 N/A INTRINSIC
SH3 721 778 2.65e-21 SMART
low complexity region 791 811 N/A INTRINSIC
SH3 855 909 8.83e-18 SMART
SH3 945 999 9.1e-20 SMART
SH3 1017 1077 1.55e-13 SMART
SH3 1091 1146 7.22e-23 SMART
RhoGEF 1174 1355 1.93e-56 SMART
PH 1396 1507 1.16e-9 SMART
C2 1531 1628 3.96e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217672
AA Change: L139*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218352
Predicted Effect probably null
Transcript: ENSMUST00000219007
AA Change: L581*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219832
Predicted Effect probably null
Transcript: ENSMUST00000220311
AA Change: L581*
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein which contains SH3 domains. This protein is a member of a family of proteins involved in clathrin-mediated endocytosis. Intersectin 2 is thought to regulate the formation of clathrin-coated vesicles and also may function in the induction of T cell antigen receptor (TCR) endocytosis. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal brain morphology and function and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Il1rap A C 16: 26,722,455 E482A probably damaging Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Itsn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Itsn2 APN 12 4658027 missense possibly damaging 0.95
IGL00647:Itsn2 APN 12 4613311 splice site probably benign
IGL00933:Itsn2 APN 12 4707540 missense probably damaging 1.00
IGL01686:Itsn2 APN 12 4636693 splice site probably benign
IGL01873:Itsn2 APN 12 4632366 splice site probably benign
IGL02200:Itsn2 APN 12 4636632 missense probably damaging 0.98
IGL02280:Itsn2 APN 12 4708961 missense possibly damaging 0.89
IGL02388:Itsn2 APN 12 4629557 missense possibly damaging 0.91
IGL02938:Itsn2 APN 12 4697216 missense probably damaging 0.98
inversus UTSW 12 4639670 nonsense probably null
liberator UTSW 12 4666176 nonsense probably null
rolled UTSW 12 4634792 nonsense probably null
stratofortress UTSW 12 4624927 missense probably damaging 1.00
R0101:Itsn2 UTSW 12 4633058 unclassified probably benign
R0268:Itsn2 UTSW 12 4700333 missense probably benign 0.12
R0584:Itsn2 UTSW 12 4697180 missense probably benign
R0604:Itsn2 UTSW 12 4658189 missense probably benign 0.01
R0639:Itsn2 UTSW 12 4712556 missense probably damaging 0.99
R0738:Itsn2 UTSW 12 4635681 missense probably benign 0.17
R1132:Itsn2 UTSW 12 4658464 missense probably damaging 1.00
R1163:Itsn2 UTSW 12 4712009 missense probably benign 0.30
R1169:Itsn2 UTSW 12 4639694 missense probably damaging 1.00
R1258:Itsn2 UTSW 12 4673464 missense probably damaging 1.00
R1297:Itsn2 UTSW 12 4700378 missense probably damaging 1.00
R1423:Itsn2 UTSW 12 4673572 missense probably damaging 0.97
R1572:Itsn2 UTSW 12 4650044 missense probably benign 0.03
R1601:Itsn2 UTSW 12 4658452 missense probably benign 0.01
R1628:Itsn2 UTSW 12 4629652 missense probably benign
R1650:Itsn2 UTSW 12 4637767 missense probably damaging 0.97
R1752:Itsn2 UTSW 12 4711950 splice site probably null
R1758:Itsn2 UTSW 12 4658160 missense possibly damaging 0.83
R1976:Itsn2 UTSW 12 4672733 splice site probably benign
R2000:Itsn2 UTSW 12 4666176 nonsense probably null
R2060:Itsn2 UTSW 12 4627879 missense probably damaging 1.00
R2119:Itsn2 UTSW 12 4707025 missense probably benign 0.32
R2168:Itsn2 UTSW 12 4633044 unclassified probably benign
R2394:Itsn2 UTSW 12 4707005 missense possibly damaging 0.86
R2860:Itsn2 UTSW 12 4700315 splice site probably benign
R2861:Itsn2 UTSW 12 4700315 splice site probably benign
R2900:Itsn2 UTSW 12 4630713 unclassified probably benign
R2991:Itsn2 UTSW 12 4658474 missense probably benign 0.01
R3087:Itsn2 UTSW 12 4666303 missense probably damaging 1.00
R3881:Itsn2 UTSW 12 4634546 unclassified probably benign
R4022:Itsn2 UTSW 12 4624927 missense probably damaging 1.00
R4332:Itsn2 UTSW 12 4712611 missense possibly damaging 0.72
R4657:Itsn2 UTSW 12 4713197 makesense probably null
R4727:Itsn2 UTSW 12 4707660 missense probably damaging 0.99
R4745:Itsn2 UTSW 12 4661944 missense probably damaging 1.00
R4770:Itsn2 UTSW 12 4627892 missense probably damaging 1.00
R4905:Itsn2 UTSW 12 4634583 unclassified probably benign
R5269:Itsn2 UTSW 12 4633553 unclassified probably benign
R5314:Itsn2 UTSW 12 4627960 missense probably benign 0.09
R5345:Itsn2 UTSW 12 4672783 missense probably damaging 1.00
R5399:Itsn2 UTSW 12 4653535 missense probably benign 0.22
R5566:Itsn2 UTSW 12 4626554 missense probably damaging 1.00
R5725:Itsn2 UTSW 12 4630767 unclassified probably benign
R5773:Itsn2 UTSW 12 4707089 missense probably damaging 1.00
R6116:Itsn2 UTSW 12 4629939 unclassified probably benign
R6254:Itsn2 UTSW 12 4624982 splice site probably null
R6325:Itsn2 UTSW 12 4706351 missense probably damaging 1.00
R6361:Itsn2 UTSW 12 4629655 missense probably benign 0.18
R6456:Itsn2 UTSW 12 4629923 unclassified probably benign
R6494:Itsn2 UTSW 12 4634792 nonsense probably null
R6854:Itsn2 UTSW 12 4652382 missense probably benign 0.37
R6941:Itsn2 UTSW 12 4629641 missense probably benign 0.05
R6961:Itsn2 UTSW 12 4673420 nonsense probably null
R7326:Itsn2 UTSW 12 4632985 missense unknown
R7387:Itsn2 UTSW 12 4639781 missense probably damaging 1.00
R7465:Itsn2 UTSW 12 4706983 nonsense probably null
R7471:Itsn2 UTSW 12 4708198 missense probably benign 0.43
Z1088:Itsn2 UTSW 12 4712472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTGATCTTTCAGTACAGAAC -3'
(R):5'- TCTAGTAGTTGGCATGGTATAAGC -3'

Sequencing Primer
(F):5'- CCTGATCTTTCAGTACAGAACTAATC -3'
(R):5'- CTGAGAGCTTAGATGCAGT -3'
Posted On2014-08-01