Incidental Mutation 'R1942:Il1rap'
ID216328
Institutional Source Beutler Lab
Gene Symbol Il1rap
Ensembl Gene ENSMUSG00000022514
Gene Nameinterleukin 1 receptor accessory protein
SynonymsIL-1RAcP, 6430709H04Rik, IL-1R AcP
MMRRC Submission 039960-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1942 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location26581704-26730117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 26722455 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 482 (E482A)
Ref Sequence ENSEMBL: ENSMUSP00000128100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023156] [ENSMUST00000096129] [ENSMUST00000166294]
Predicted Effect probably benign
Transcript: ENSMUST00000023156
SMART Domains Protein: ENSMUSP00000023156
Gene: ENSMUSG00000022514

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 549 5.29e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096129
AA Change: E482A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093843
Gene: ENSMUSG00000022514
AA Change: E482A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166294
AA Change: E482A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128100
Gene: ENSMUSG00000022514
AA Change: E482A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 32 132 1.21e-2 SMART
IG 145 232 4.04e0 SMART
IG 251 350 1.46e-5 SMART
low complexity region 368 381 N/A INTRINSIC
TIR 404 547 1.38e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172522
Predicted Effect unknown
Transcript: ENSMUST00000173136
AA Change: E7A
SMART Domains Protein: ENSMUSP00000133294
Gene: ENSMUSG00000022514
AA Change: E7A

DomainStartEndE-ValueType
Blast:TIR 2 154 3e-48 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174644
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. This gene encodes the interleukin 1 receptor accessory protein. The protein is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal but show no biological response to IL-1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A C 13: 68,612,971 I171L probably benign Het
4930407I10Rik A T 15: 82,065,424 Y1174F probably damaging Het
Ahnak A G 19: 9,015,083 E4577G probably damaging Het
Anapc4 T C 5: 52,846,714 V291A probably benign Het
Apba2 A G 7: 64,695,470 E136G possibly damaging Het
Arhgap20 C A 9: 51,831,698 Q279K probably benign Het
B3galnt1 A T 3: 69,575,925 M1K probably null Het
C4bp C A 1: 130,656,067 probably benign Het
Catsperg1 G A 7: 29,206,807 T157I possibly damaging Het
Chrm1 T A 19: 8,678,273 M114K probably damaging Het
Clasp1 A G 1: 118,501,348 E329G possibly damaging Het
Clrn2 A C 5: 45,453,995 Y62S probably benign Het
Col12a1 T G 9: 79,635,466 D2339A probably damaging Het
Copa T A 1: 172,111,888 L564Q probably damaging Het
Cpeb2 C A 5: 43,235,253 probably benign Het
Dhx57 A T 17: 80,265,144 M647K probably damaging Het
Diaph3 C T 14: 87,141,120 probably benign Het
Eomes A G 9: 118,484,648 D587G probably benign Het
Gm5142 T A 14: 59,178,707 M1L probably benign Het
Gnl2 A G 4: 125,030,164 I12V probably benign Het
Gprin1 C T 13: 54,739,939 C174Y probably benign Het
Grin2b A T 6: 135,732,732 V1272E possibly damaging Het
Hdac9 A G 12: 34,429,545 L227S probably damaging Het
Helz T A 11: 107,602,492 L247Q probably benign Het
Hs6st1 T C 1: 36,068,722 V22A probably benign Het
Hspg2 C A 4: 137,542,552 A2304E possibly damaging Het
Htr3a T C 9: 48,908,611 Y73C probably damaging Het
Itsn2 T A 12: 4,639,670 L581* probably null Het
Msmb A G 14: 32,148,077 E2G probably benign Het
Muc19 T C 15: 91,892,472 noncoding transcript Het
Muc4 A C 16: 32,750,642 L173F probably damaging Het
Muc5b A T 7: 141,857,684 S1456C unknown Het
Mylip A T 13: 45,406,696 I203F probably damaging Het
Nckap5 A T 1: 126,024,302 D1504E probably damaging Het
Neil1 C G 9: 57,146,607 R143P probably benign Het
Nlrp2 T A 7: 5,322,448 T742S probably damaging Het
Nme8 A G 13: 19,675,808 V214A probably damaging Het
Nsun7 C T 5: 66,284,245 T419I probably benign Het
Nup210l G A 3: 90,151,237 E648K probably benign Het
Olfr1386 T C 11: 49,470,154 M1T probably null Het
Olfr283 A G 15: 98,378,564 L182P probably damaging Het
Olfr981 T A 9: 40,022,735 L114H probably damaging Het
Olfr981 T C 9: 40,022,752 Y120H probably damaging Het
Parp11 A C 6: 127,470,700 probably null Het
Pomgnt1 G T 4: 116,155,275 probably null Het
Ppp1r14c T C 10: 3,463,417 I150T probably damaging Het
Psd4 A G 2: 24,405,793 E908G probably damaging Het
Psmd6 A T 14: 14,116,442 V91E probably damaging Het
Ptk2b A T 14: 66,169,381 V634D probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rbm45 G A 2: 76,375,479 probably null Het
Ric1 A G 19: 29,601,016 probably benign Het
Sh3rf2 A G 18: 42,149,624 K416E probably damaging Het
Six5 C T 7: 19,096,933 A495V possibly damaging Het
Slc27a6 T A 18: 58,556,798 M112K probably damaging Het
Slc5a4a T C 10: 76,147,588 S20P unknown Het
Smg1 A G 7: 118,158,103 probably benign Het
Sntb2 G A 8: 107,011,352 A511T probably damaging Het
Stk31 A T 6: 49,439,127 N622I probably damaging Het
Sulf1 T C 1: 12,848,173 F38S probably damaging Het
Szt2 G T 4: 118,392,620 T521K probably benign Het
Terf1 G T 1: 15,805,814 R46I probably benign Het
Tmem245 A G 4: 56,923,511 probably benign Het
Tmigd1 T C 11: 76,914,079 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Umod A G 7: 119,476,932 Y204H probably damaging Het
Vcan T A 13: 89,703,424 Q1139L probably benign Het
Vmn1r85 T A 7: 13,084,741 T159S possibly damaging Het
Vmn2r103 T A 17: 19,812,300 S779T probably benign Het
Vmn2r27 C T 6: 124,223,763 A412T probably damaging Het
Zc3h12d A C 10: 7,853,313 D147A probably damaging Het
Zfp800 A T 6: 28,243,273 D564E probably benign Het
Zfp932 A G 5: 110,006,987 E17G probably damaging Het
Other mutations in Il1rap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Il1rap APN 16 26722401 missense possibly damaging 0.77
IGL00976:Il1rap APN 16 26698839 missense probably benign 0.09
IGL01075:Il1rap APN 16 26680237 missense possibly damaging 0.94
IGL01665:Il1rap APN 16 26722713 missense probably damaging 1.00
IGL01962:Il1rap APN 16 26710568 nonsense probably null
IGL02101:Il1rap APN 16 26624182 missense possibly damaging 0.61
IGL02411:Il1rap APN 16 26710616 missense probably damaging 1.00
IGL03132:Il1rap APN 16 26680119 missense probably damaging 1.00
bacchus UTSW 16 26710632 critical splice donor site probably null
I1329:Il1rap UTSW 16 26692850 missense probably benign 0.07
LCD18:Il1rap UTSW 16 26631593 intron probably benign
PIT1430001:Il1rap UTSW 16 26710593 missense possibly damaging 0.53
R0302:Il1rap UTSW 16 26692794 missense probably benign 0.02
R0454:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R0481:Il1rap UTSW 16 26692835 missense probably damaging 1.00
R0612:Il1rap UTSW 16 26701105 missense possibly damaging 0.48
R0765:Il1rap UTSW 16 26710632 critical splice donor site probably null
R1552:Il1rap UTSW 16 26722434 missense possibly damaging 0.79
R1801:Il1rap UTSW 16 26698875 missense probably damaging 1.00
R1867:Il1rap UTSW 16 26722926 missense probably damaging 1.00
R1996:Il1rap UTSW 16 26722493 missense probably benign 0.06
R2118:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2122:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R2124:Il1rap UTSW 16 26710565 missense probably damaging 1.00
R3104:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3105:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3106:Il1rap UTSW 16 26722752 missense probably benign 0.01
R3891:Il1rap UTSW 16 26676856 missense probably damaging 1.00
R4133:Il1rap UTSW 16 26722886 missense probably benign 0.34
R4409:Il1rap UTSW 16 26712265 splice site probably null
R4610:Il1rap UTSW 16 26714776 missense probably benign 0.11
R4755:Il1rap UTSW 16 26722782 missense probably benign 0.20
R4776:Il1rap UTSW 16 26692799 missense possibly damaging 0.57
R4793:Il1rap UTSW 16 26695234 missense probably benign 0.09
R4811:Il1rap UTSW 16 26701238 critical splice donor site probably null
R4834:Il1rap UTSW 16 26676935 missense probably damaging 1.00
R5119:Il1rap UTSW 16 26624199 missense probably benign 0.01
R5744:Il1rap UTSW 16 26680224 missense probably benign 0.01
R6108:Il1rap UTSW 16 26722707 missense probably damaging 1.00
R6149:Il1rap UTSW 16 26712219 missense probably damaging 1.00
R6233:Il1rap UTSW 16 26710506 missense probably benign 0.24
R6246:Il1rap UTSW 16 26714881 missense probably benign
R6249:Il1rap UTSW 16 26692848 missense possibly damaging 0.88
R6254:Il1rap UTSW 16 26695270 missense probably benign
R6748:Il1rap UTSW 16 26722356 missense probably benign 0.02
R7151:Il1rap UTSW 16 26712128 missense probably damaging 1.00
X0027:Il1rap UTSW 16 26701147 missense probably benign 0.20
X0028:Il1rap UTSW 16 26676964 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGACAACTACCAGCTGG -3'
(R):5'- GAACAGCTCTCATTCCAGCC -3'

Sequencing Primer
(F):5'- AACTACCAGCTGGATATGGATAC -3'
(R):5'- CTCAGACTTCTCAGGGGAAGAGC -3'
Posted On2014-08-01