Incidental Mutation 'R0131:Ubr4'
ID21634
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Nameubiquitin protein ligase E3 component n-recognin 4
SynonymsLOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik
MMRRC Submission 038416-MU
Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0131 (G1)
Quality Score220
Status Validated (trace)
Chromosome4
Chromosomal Location139352609-139489588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139464051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 4127 (T4127A)
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000147999] [ENSMUST00000165860]
Predicted Effect unknown
Transcript: ENSMUST00000097822
AA Change: T4151A
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: T4151A

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136230
Predicted Effect possibly damaging
Transcript: ENSMUST00000147999
AA Change: T992A

PolyPhen 2 Score 0.651 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036
AA Change: T992A

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165860
AA Change: T4127A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: T4127A

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 90.2%
  • 20x: 71.5%
Validation Efficiency 87% (52/60)
MGI Phenotype Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abca8b T A 11: 109,942,289 Q1195L possibly damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Adgrv1 A T 13: 81,502,995 probably benign Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Arntl2 C A 6: 146,828,103 H471N probably benign Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bicd1 A G 6: 149,512,947 E386G probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Cacna1c T C 6: 118,625,512 I1428V probably damaging Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Cldnd1 T C 16: 58,732,992 L232P probably damaging Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Col3a1 T A 1: 45,328,868 probably benign Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Cyc1 G A 15: 76,344,959 V142I probably benign Het
Dapk3 A G 10: 81,192,307 T265A probably benign Het
Ddx21 A T 10: 62,584,752 M711K possibly damaging Het
Dlg5 A T 14: 24,138,649 L1735Q probably damaging Het
Dse A G 10: 34,153,664 Y341H probably damaging Het
Elmod2 A G 8: 83,319,504 I148T probably damaging Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Faxc A G 4: 21,936,659 D98G probably damaging Het
Fcrls A G 3: 87,258,959 S170P possibly damaging Het
Fsip2 G A 2: 82,991,121 D5733N probably benign Het
Gbe1 T C 16: 70,360,852 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
Gm6327 T C 16: 12,761,045 noncoding transcript Het
Gm9745 T A 13: 8,940,527 probably benign Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Kmt2b A T 7: 30,583,921 C296S probably damaging Het
Lgals4 A G 7: 28,834,232 probably null Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Mylk T C 16: 34,875,504 V203A probably benign Het
Myom2 A G 8: 15,083,329 N407S probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Olfr720 T C 14: 14,175,620 D154G probably benign Het
Pate3 A G 9: 35,646,157 C68R probably damaging Het
Pcdh15 A G 10: 74,170,608 D106G probably null Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Proc C T 18: 32,135,898 M11I probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Psg21 A G 7: 18,654,868 Y100H probably benign Het
Pten T A 19: 32,776,069 V45E probably benign Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rab7b T C 1: 131,698,555 L107P probably damaging Het
Rbm47 T A 5: 66,026,529 T244S possibly damaging Het
Rhbdf2 C A 11: 116,605,344 G122C probably damaging Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc12a3 G A 8: 94,340,883 probably benign Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Spg11 T C 2: 122,070,968 E1497G probably damaging Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tet3 C G 6: 83,368,788 G1556R probably damaging Het
Tgfbr3 A G 5: 107,132,816 S693P probably benign Het
Tmcc2 C T 1: 132,380,706 G150D probably benign Het
Tmem216 T C 19: 10,554,606 Y44C probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Wrnip1 G A 13: 32,806,864 V369I probably damaging Het
Zc3h12c T A 9: 52,126,623 I305F possibly damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139465322 missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139428566 missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139455184 missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139421245 missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139440766 missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139476282 missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL01126:Ubr4 APN 4 139402555 missense probably benign 0.04
IGL01311:Ubr4 APN 4 139479045 missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139480728 missense unknown
IGL01388:Ubr4 APN 4 139460243 missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139410800 missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139438040 splice site probably benign
IGL01449:Ubr4 APN 4 139412736 missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139442829 splice site probably benign
IGL01568:Ubr4 APN 4 139421373 missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139462534 splice site probably benign
IGL01621:Ubr4 APN 4 139440783 nonsense probably null
IGL01639:Ubr4 APN 4 139417344 missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139407796 missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139418461 missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139472500 missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139477158 missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139412678 nonsense probably null
IGL01874:Ubr4 APN 4 139393289 splice site probably benign
IGL01889:Ubr4 APN 4 139462472 nonsense probably null
IGL01891:Ubr4 APN 4 139436260 critical splice donor site probably null
IGL01980:Ubr4 APN 4 139429602 missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139452741 critical splice donor site probably null
IGL02153:Ubr4 APN 4 139460160 nonsense probably null
IGL02173:Ubr4 APN 4 139437070 splice site probably null
IGL02214:Ubr4 APN 4 139428583 missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139461827 critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139388435 missense probably benign 0.01
IGL02246:Ubr4 APN 4 139459103 missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139455628 nonsense probably null
IGL02273:Ubr4 APN 4 139472578 missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139473178 missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139478922 missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139421249 nonsense probably null
IGL02477:Ubr4 APN 4 139436205 missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139415118 missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139467250 nonsense probably null
IGL02679:Ubr4 APN 4 139459134 missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139468811 missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139410784 missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL02892:Ubr4 APN 4 139417331 missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139472508 missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139425295 missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139407820 missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139480676 missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139409730 missense probably benign 0.02
IGL03087:Ubr4 APN 4 139450357 nonsense probably null
IGL03116:Ubr4 APN 4 139479581 splice site probably benign
IGL03212:Ubr4 APN 4 139409763 missense probably benign 0.13
IGL03228:Ubr4 APN 4 139429598 missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139440435 missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139415032 missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139452678 missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139399929 nonsense probably null
P0019:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
R0001:Ubr4 UTSW 4 139451788 missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139390900 missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0008:Ubr4 UTSW 4 139430176 missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139426793 missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0088:Ubr4 UTSW 4 139440814 missense probably damaging 1.00
R0184:Ubr4 UTSW 4 139445262 missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139430257 missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0270:Ubr4 UTSW 4 139479435 splice site probably benign
R0285:Ubr4 UTSW 4 139440801 missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139422418 missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139391860 missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139410860 splice site probably benign
R0450:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0504:Ubr4 UTSW 4 139406578 missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R0510:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0513:Ubr4 UTSW 4 139416875 missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139392124 missense probably benign 0.00
R0558:Ubr4 UTSW 4 139426902 missense probably benign 0.09
R0617:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R0636:Ubr4 UTSW 4 139436302 intron probably null
R0637:Ubr4 UTSW 4 139399615 missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139401326 missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139423906 missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139485320 missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139428028 splice site probably null
R0751:Ubr4 UTSW 4 139437198 splice site probably benign
R0789:Ubr4 UTSW 4 139410271 critical splice donor site probably null
R0825:Ubr4 UTSW 4 139479576 critical splice donor site probably null
R0828:Ubr4 UTSW 4 139450553 splice site probably benign
R1052:Ubr4 UTSW 4 139455460 missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139437198 splice site probably benign
R1222:Ubr4 UTSW 4 139388471 splice site probably null
R1258:Ubr4 UTSW 4 139426914 missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139460123 missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139402612 missense probably benign 0.00
R1450:Ubr4 UTSW 4 139468028 missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1474:Ubr4 UTSW 4 139429579 missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139425840 missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139428151 missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139416927 nonsense probably null
R1785:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139393053 missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139428596 missense probably benign 0.25
R1800:Ubr4 UTSW 4 139407963 missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139452563 splice site probably null
R1827:Ubr4 UTSW 4 139425697 critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139455560 missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139451244 critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139480652 missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139479540 missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139429611 nonsense probably null
R2140:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R2237:Ubr4 UTSW 4 139442790 missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139448921 missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139413462 missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139420373 splice site probably benign
R2353:Ubr4 UTSW 4 139433673 missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139473542 missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139473205 unclassified probably benign
R2896:Ubr4 UTSW 4 139455644 splice site probably null
R2922:Ubr4 UTSW 4 139479500 missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2973:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2989:Ubr4 UTSW 4 139463558 missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3276:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3772:Ubr4 UTSW 4 139452700 missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139459126 missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139423990 missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R3951:Ubr4 UTSW 4 139393094 missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139451805 missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139393414 missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139472509 missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139410440 missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139418502 missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139380853 missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139399579 missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139406518 missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139436191 missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139408672 missense probably benign 0.09
R4701:Ubr4 UTSW 4 139471336 missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139450529 missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139482579 missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139423879 missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139421733 missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139402546 missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139428517 missense probably benign 0.14
R4936:Ubr4 UTSW 4 139396566 missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139436169 missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139410623 missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R5197:Ubr4 UTSW 4 139468097 missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139402566 nonsense probably null
R5219:Ubr4 UTSW 4 139477232 nonsense probably null
R5346:Ubr4 UTSW 4 139428491 missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139397528 intron probably benign
R5442:Ubr4 UTSW 4 139407772 missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139480788 missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139460090 missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139392038 missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139452648 missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139444687 missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139428583 missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139460095 missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139468096 missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139425218 missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139468847 missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139425330 missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139408626 nonsense probably null
R5901:Ubr4 UTSW 4 139451254 missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139455638 missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139421078 splice site probably null
R6060:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R6065:Ubr4 UTSW 4 139421238 missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139417364 missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139421248 missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139452640 missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139408889 missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139429539 missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139429638 missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139397214 critical splice donor site probably null
R6481:Ubr4 UTSW 4 139431751 missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139444671 missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139414394 missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139455586 missense probably benign 0.17
R6648:Ubr4 UTSW 4 139452719 nonsense probably null
R6649:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139465341 missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139489182 missense unknown
R6772:Ubr4 UTSW 4 139467230 nonsense probably null
R6857:Ubr4 UTSW 4 139486051 missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139467227 missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139458234 critical splice donor site probably null
R6943:Ubr4 UTSW 4 139437131 nonsense probably null
R6970:Ubr4 UTSW 4 139406528 nonsense probably null
R6976:Ubr4 UTSW 4 139393077 missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139414404 missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139393090 missense probably damaging 0.99
T0975:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139410271 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCACCAACAGGGACAGGTCACAG -3'
(R):5'- TGCTCAGAGGCGCTCAACAAAC -3'

Sequencing Primer
(F):5'- GGTCACAGTAGAACTGTCCTC -3'
(R):5'- AATACCCTAAAGTGCTGGCTTCTG -3'
Posted On2013-04-11