Incidental Mutation 'R0131:Bicd1'
ID21640
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 038416-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0131 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149512947 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 386 (E386G)
Ref Sequence ENSEMBL: ENSMUSP00000003544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000172926] [ENSMUST00000173408]
Predicted Effect probably damaging
Transcript: ENSMUST00000003544
AA Change: E386G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: E386G

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086829
AA Change: E386G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: E386G

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111513
AA Change: E386G

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: E386G

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172926
SMART Domains Protein: ENSMUSP00000133986
Gene: ENSMUSG00000003452

DomainStartEndE-ValueType
Pfam:BicD 1 98 1.2e-69 PFAM
low complexity region 103 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: E386G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: E386G

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174886
Meta Mutation Damage Score 0.354 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.2%
  • 10x: 90.2%
  • 20x: 71.5%
Validation Efficiency 87% (52/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,137,615 R320G probably damaging Het
Abca8b T A 11: 109,942,289 Q1195L possibly damaging Het
Abcc12 A G 8: 86,531,568 I773T probably benign Het
Adamtsl1 T A 4: 86,342,723 I1057N possibly damaging Het
Adgrv1 A T 13: 81,502,995 probably benign Het
Anxa5 G A 3: 36,450,672 A247V probably damaging Het
Arntl2 C A 6: 146,828,103 H471N probably benign Het
Ascc3 T G 10: 50,735,329 W1589G probably damaging Het
Atp2b2 G A 6: 113,793,782 P389S probably damaging Het
Bpifa6 T A 2: 153,982,931 S9T probably benign Het
Cacna1c T C 6: 118,625,512 I1428V probably damaging Het
Chd8 A G 14: 52,205,326 V589A probably benign Het
Chrnb2 T C 3: 89,764,406 M1V probably null Het
Cldnd1 T C 16: 58,732,992 L232P probably damaging Het
Col16a1 T A 4: 130,067,096 V449E unknown Het
Col3a1 T A 1: 45,328,868 probably benign Het
Cttnbp2nl T G 3: 105,005,857 K237T probably damaging Het
Cyc1 G A 15: 76,344,959 V142I probably benign Het
Dapk3 A G 10: 81,192,307 T265A probably benign Het
Ddx21 A T 10: 62,584,752 M711K possibly damaging Het
Dlg5 A T 14: 24,138,649 L1735Q probably damaging Het
Dse A G 10: 34,153,664 Y341H probably damaging Het
Elmod2 A G 8: 83,319,504 I148T probably damaging Het
Fam187b T A 7: 30,989,120 V22E probably damaging Het
Faxc A G 4: 21,936,659 D98G probably damaging Het
Fcrls A G 3: 87,258,959 S170P possibly damaging Het
Fsip2 G A 2: 82,991,121 D5733N probably benign Het
Gbe1 T C 16: 70,360,852 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm4788 T A 1: 139,754,271 T196S probably damaging Het
Gm6327 T C 16: 12,761,045 noncoding transcript Het
Gm9745 T A 13: 8,940,527 probably benign Het
H2-T24 T A 17: 36,014,986 I238F probably damaging Het
Hectd4 A G 5: 121,333,024 E2658G probably benign Het
Herc1 A C 9: 66,480,910 I3826L probably benign Het
Hinfp A G 9: 44,299,763 C67R probably damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Hspg2 T C 4: 137,551,887 Y3094H probably damaging Het
Htr1f A G 16: 64,926,728 V67A probably damaging Het
Iqcc T G 4: 129,616,599 E374D probably damaging Het
Kcnj9 T C 1: 172,326,198 T120A probably damaging Het
Kitl C T 10: 100,087,364 P208S probably benign Het
Kmt2b A T 7: 30,583,921 C296S probably damaging Het
Lgals4 A G 7: 28,834,232 probably null Het
Lpcat4 A G 2: 112,246,748 Y479C probably damaging Het
Lrrc74b T C 16: 17,553,152 N227S probably damaging Het
Mdc1 T A 17: 35,852,581 V1007D probably damaging Het
Mocos T G 18: 24,679,762 I571S probably benign Het
Myh8 A G 11: 67,292,188 N659D probably damaging Het
Mylk T C 16: 34,875,504 V203A probably benign Het
Myom2 A G 8: 15,083,329 N407S probably damaging Het
Naip2 A G 13: 100,183,788 V240A probably benign Het
Nap1l1 T C 10: 111,485,509 S37P probably benign Het
Nin T G 12: 70,051,141 K515T probably damaging Het
Npl T A 1: 153,509,118 K258* probably null Het
Ntn4 T A 10: 93,644,707 S98T possibly damaging Het
Olfr1037 T C 2: 86,085,500 I92M probably damaging Het
Olfr177 C A 16: 58,872,906 M81I probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr417 T C 1: 174,369,586 V223A probably damaging Het
Olfr720 T C 14: 14,175,620 D154G probably benign Het
Pate3 A G 9: 35,646,157 C68R probably damaging Het
Pcdh15 A G 10: 74,170,608 D106G probably null Het
Ppox C A 1: 171,279,275 A192S possibly damaging Het
Prkdc T C 16: 15,713,653 L1380S probably benign Het
Proc C T 18: 32,135,898 M11I probably benign Het
Psd4 C A 2: 24,405,351 A839E probably damaging Het
Psg21 A G 7: 18,654,868 Y100H probably benign Het
Pten T A 19: 32,776,069 V45E probably benign Het
Ptprn2 T G 12: 116,722,091 F57V probably damaging Het
Ptprt C T 2: 162,278,110 V146I probably benign Het
R3hdm2 T A 10: 127,498,453 M915K probably damaging Het
Rab26 C T 17: 24,530,785 probably null Het
Rab7b T C 1: 131,698,555 L107P probably damaging Het
Rbm47 T A 5: 66,026,529 T244S possibly damaging Het
Rhbdf2 C A 11: 116,605,344 G122C probably damaging Het
Rnf213 A G 11: 119,430,361 E1215G probably benign Het
Rprd2 T C 3: 95,774,361 K407E probably damaging Het
Siah3 G A 14: 75,456,134 V27I possibly damaging Het
Slc12a3 G A 8: 94,340,883 probably benign Het
Slc14a2 T A 18: 78,192,123 N280Y probably damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a35 A G 11: 68,971,960 Y247C probably damaging Het
Slc29a4 A G 5: 142,705,530 D55G probably benign Het
Slc35d1 C T 4: 103,208,181 V189I probably benign Het
Spg11 T C 2: 122,070,968 E1497G probably damaging Het
Srrm1 G A 4: 135,340,573 R322* probably null Het
Stac3 A T 10: 127,503,650 R138S probably damaging Het
Tet3 C G 6: 83,368,788 G1556R probably damaging Het
Tgfbr3 A G 5: 107,132,816 S693P probably benign Het
Tmcc2 C T 1: 132,380,706 G150D probably benign Het
Tmem216 T C 19: 10,554,606 Y44C probably damaging Het
Tmem260 T A 14: 48,483,322 C306* probably null Het
Tspyl1 A G 10: 34,283,089 N270S probably damaging Het
Ubr4 A G 4: 139,464,051 T4127A possibly damaging Het
Ugt2a2 T A 5: 87,474,861 K293* probably null Het
Vmn2r102 A C 17: 19,678,763 T456P probably benign Het
Vmn2r90 T A 17: 17,712,249 S139R probably benign Het
Wrnip1 G A 13: 32,806,864 V369I probably damaging Het
Zc3h12c T A 9: 52,126,623 I305F possibly damaging Het
Zmym2 A G 14: 56,943,258 N876D probably benign Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
R7526:Bicd1 UTSW 6 149513726 missense possibly damaging 0.46
R7545:Bicd1 UTSW 6 149513492 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTTTCCCTGAAGTGATTCAGAC -3'
(R):5'- GGCTATGCCAGTCATCTTTTGCAAC -3'

Sequencing Primer
(F):5'- ATTCAGACATTGTCTTCTGTCATTAC -3'
(R):5'- GATGTCTTCTCAAGGTTTGTCAC -3'
Posted On2013-04-11