Incidental Mutation 'R1943:Parp14'
ID216401
Institutional Source Beutler Lab
Gene Symbol Parp14
Ensembl Gene ENSMUSG00000034422
Gene Namepoly (ADP-ribose) polymerase family, member 14
Synonymscollaborator of Stat6, 1600029O10Rik, CoaSt6
MMRRC Submission 039961-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R1943 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35832874-35871544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35836129 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1676 (Y1676H)
Ref Sequence ENSEMBL: ENSMUSP00000037657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042665]
PDB Structure
Solution structure of WWE domain in Parp14 protein [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000042665
AA Change: Y1676H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037657
Gene: ENSMUSG00000034422
AA Change: Y1676H

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 93 115 N/A INTRINSIC
RRM 228 297 4.71e-2 SMART
coiled coil region 443 468 N/A INTRINSIC
Blast:A1pp 693 746 6e-6 BLAST
low complexity region 771 795 N/A INTRINSIC
A1pp 814 948 7.62e-41 SMART
A1pp 1026 1160 5.88e-24 SMART
A1pp 1239 1358 6.82e-20 SMART
PDB:1X4R|A 1532 1619 9e-53 PDB
Pfam:PARP 1632 1817 2.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231601
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase (PARP) protein family. The encoded anti-apoptotic protein may regulate aerobic glycolysis and promote survival of cancer cells. Increased expression of this gene has been reported in a variety of tumor types. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit altered B cell subsets and inability to respond to the apoptosis protective affects of IL4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,547 N1017S possibly damaging Het
Abca8a T C 11: 110,069,863 I610V probably benign Het
Acp5 C T 9: 22,129,604 V108M probably damaging Het
Adam23 T C 1: 63,477,757 probably null Het
Adam34 T A 8: 43,650,827 T594S possibly damaging Het
Adam34 A T 8: 43,651,815 N264K probably damaging Het
Arsa G A 15: 89,473,539 T407I probably damaging Het
Bicc1 A G 10: 71,159,523 S32P probably damaging Het
Cacna1i T A 15: 80,395,044 D1995E probably benign Het
Chst15 A T 7: 132,262,850 probably null Het
Cntnap4 T A 8: 112,815,496 F754I probably benign Het
Cpz C T 5: 35,512,428 E302K probably damaging Het
Daw1 A T 1: 83,209,266 I371F possibly damaging Het
Dennd1b C A 1: 139,168,952 probably benign Het
Dhtkd1 T G 2: 5,932,482 Q73P probably benign Het
Dmgdh T C 13: 93,711,370 I525T probably benign Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc3 A G 18: 32,246,610 Y290C probably damaging Het
Fh1 C T 1: 175,609,778 V252I probably benign Het
Gm13199 C T 2: 5,862,706 probably benign Het
Il1rn T C 2: 24,348,599 S82P possibly damaging Het
Lama4 T C 10: 39,097,138 V1567A possibly damaging Het
Lamtor4 A G 5: 138,255,792 probably null Het
Llgl1 A G 11: 60,706,016 N148D probably benign Het
Lmo7 G T 14: 101,902,302 G774V probably damaging Het
Luzp2 A T 7: 55,264,302 K293M possibly damaging Het
Mknk1 T C 4: 115,863,026 V83A probably damaging Het
Mug2 T C 6: 122,079,639 V1181A probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Olfr169 A T 16: 19,566,437 W149R probably benign Het
Olfr51 A G 11: 51,007,675 I234M probably benign Het
Osbpl3 A G 6: 50,320,074 I548T probably benign Het
Phtf1 A T 3: 103,993,882 K416* probably null Het
Pmp2 T C 3: 10,182,510 T40A probably benign Het
Ptpra T C 2: 130,544,104 M541T probably damaging Het
Rapgef6 A G 11: 54,657,263 I753V possibly damaging Het
Rdh14 T C 12: 10,391,162 V108A probably benign Het
Rnf38 A T 4: 44,138,748 H248Q probably damaging Het
Rsph6a A C 7: 19,074,076 Y388S probably damaging Het
Ryr2 T C 13: 11,731,723 D1981G probably benign Het
Sf3a3 A G 4: 124,715,901 K97E possibly damaging Het
Shisa9 A G 16: 12,267,756 T394A probably benign Het
Slc43a2 T A 11: 75,545,741 probably null Het
Slc45a1 A G 4: 150,644,277 F23S probably benign Het
Slc7a10 T A 7: 35,200,298 V435E probably benign Het
Snx15 A G 19: 6,128,066 Y28H probably damaging Het
Spef2 T G 15: 9,663,194 K834Q possibly damaging Het
Tdpoz2 G T 3: 93,651,923 Y247* probably null Het
Tedc2 G A 17: 24,217,949 R271W possibly damaging Het
Tfr2 C A 5: 137,578,921 H378Q probably benign Het
Tigit T A 16: 43,649,218 H170L probably benign Het
Tmem2 G A 19: 21,848,040 probably null Het
Tmem62 A T 2: 120,986,626 Q91L probably benign Het
Tmtc1 G T 6: 148,425,918 C32* probably null Het
Txndc12 G A 4: 108,856,210 V90I probably benign Het
Vmn2r93 C A 17: 18,325,801 T645K probably benign Het
Vmn2r96 C T 17: 18,586,402 T345I probably benign Het
Vps13d A T 4: 145,155,857 D1055E probably benign Het
Xirp2 A G 2: 67,512,615 I1733M probably benign Het
Zfp512b T C 2: 181,588,415 H516R probably damaging Het
Zfp606 T C 7: 12,493,688 S521P probably damaging Het
Zfp715 A T 7: 43,299,630 V302E possibly damaging Het
Other mutations in Parp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Parp14 APN 16 35841075 missense probably benign 0.00
IGL00497:Parp14 APN 16 35834836 missense probably damaging 1.00
IGL00754:Parp14 APN 16 35839371 missense probably benign 0.15
IGL00960:Parp14 APN 16 35841219 missense probably benign 0.20
IGL01321:Parp14 APN 16 35856559 missense probably benign
IGL01397:Parp14 APN 16 35858728 missense probably benign 0.19
IGL01591:Parp14 APN 16 35858507 missense possibly damaging 0.71
IGL01728:Parp14 APN 16 35857435 missense probably damaging 1.00
IGL01734:Parp14 APN 16 35858600 missense probably benign 0.00
IGL02156:Parp14 APN 16 35858597 missense probably benign 0.13
IGL02951:Parp14 APN 16 35858533 missense probably benign 0.06
IGL03067:Parp14 APN 16 35856508 missense probably benign 0.10
IGL03135:Parp14 APN 16 35858011 missense probably damaging 1.00
IGL03141:Parp14 APN 16 35839293 missense probably benign 0.00
IGL03146:Parp14 APN 16 35858453 nonsense probably null
IGL03333:Parp14 APN 16 35841430 missense probably benign 0.08
IGL03391:Parp14 APN 16 35858270 missense probably benign
thurston UTSW 16 35844415 splice site probably benign
R0306:Parp14 UTSW 16 35856574 missense probably benign
R0506:Parp14 UTSW 16 35841409 missense possibly damaging 0.70
R0586:Parp14 UTSW 16 35841012 missense probably benign 0.00
R0606:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0612:Parp14 UTSW 16 35856760 missense probably benign 0.09
R0699:Parp14 UTSW 16 35860585 missense probably damaging 1.00
R0786:Parp14 UTSW 16 35840802 missense possibly damaging 0.86
R0883:Parp14 UTSW 16 35858518 missense probably benign 0.03
R0900:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1087:Parp14 UTSW 16 35858288 missense probably damaging 1.00
R1104:Parp14 UTSW 16 35844415 splice site probably benign
R1120:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1134:Parp14 UTSW 16 35834902 missense probably damaging 1.00
R1153:Parp14 UTSW 16 35857671 missense possibly damaging 0.49
R1159:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1160:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1237:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1238:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1239:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1423:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1511:Parp14 UTSW 16 35857224 missense probably benign 0.00
R1518:Parp14 UTSW 16 35856638 missense possibly damaging 0.79
R1619:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1707:Parp14 UTSW 16 35857849 missense probably damaging 1.00
R1792:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1831:Parp14 UTSW 16 35858588 missense possibly damaging 0.77
R1840:Parp14 UTSW 16 35863449 missense probably damaging 1.00
R1889:Parp14 UTSW 16 35856760 missense probably benign 0.09
R1902:Parp14 UTSW 16 35853518 critical splice donor site probably null
R1954:Parp14 UTSW 16 35858301 missense probably benign 0.08
R2115:Parp14 UTSW 16 35858534 missense probably benign 0.16
R2216:Parp14 UTSW 16 35857205 missense probably benign 0.00
R2519:Parp14 UTSW 16 35858203 missense possibly damaging 0.95
R3851:Parp14 UTSW 16 35853748 missense possibly damaging 0.92
R4052:Parp14 UTSW 16 35858401 missense probably benign 0.05
R4671:Parp14 UTSW 16 35858321 missense probably benign 0.00
R4867:Parp14 UTSW 16 35857327 missense probably benign 0.01
R4941:Parp14 UTSW 16 35846033 missense probably benign
R4992:Parp14 UTSW 16 35841142 missense probably benign 0.05
R5055:Parp14 UTSW 16 35844363 missense probably benign 0.00
R5073:Parp14 UTSW 16 35834707 missense probably damaging 0.99
R5170:Parp14 UTSW 16 35857279 missense probably benign 0.21
R5422:Parp14 UTSW 16 35866175 missense probably benign 0.01
R5543:Parp14 UTSW 16 35834767 missense probably benign 0.00
R5549:Parp14 UTSW 16 35841135 missense probably benign 0.00
R5553:Parp14 UTSW 16 35856936 missense probably benign 0.01
R5691:Parp14 UTSW 16 35863539 missense probably benign 0.12
R5774:Parp14 UTSW 16 35858410 missense probably damaging 1.00
R5855:Parp14 UTSW 16 35840927 nonsense probably null
R5942:Parp14 UTSW 16 35839367 missense probably damaging 0.98
R5990:Parp14 UTSW 16 35841457 missense probably benign 0.14
R5991:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6018:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6022:Parp14 UTSW 16 35841457 missense probably benign 0.14
R6075:Parp14 UTSW 16 35857019 missense probably damaging 0.99
R6395:Parp14 UTSW 16 35856548 missense probably benign 0.00
R6525:Parp14 UTSW 16 35860441 missense probably benign 0.05
R6683:Parp14 UTSW 16 35834677 missense probably damaging 1.00
X0026:Parp14 UTSW 16 35857157 nonsense probably null
X0060:Parp14 UTSW 16 35834707 missense probably damaging 0.99
Z1088:Parp14 UTSW 16 35841586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACTGGATGGAGATTGATGTCTG -3'
(R):5'- GGGATCAAACTCATGTCACCATAC -3'

Sequencing Primer
(F):5'- ATGTCTGAGTGGCAATTCCCAGAC -3'
(R):5'- GTCACCATACACTTAGTAAGCTGTC -3'
Posted On2014-08-01