Incidental Mutation 'R1944:Gm8251'
ID216411
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission 039962-MU
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44061849 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 30 (P30S)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect probably damaging
Transcript: ENSMUST00000168641
AA Change: P30S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: P30S

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cacna1c A G 6: 118,606,266 I1516T probably damaging Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Mettl8 A T 2: 70,973,279 F268L probably damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Nav3 T C 10: 109,716,530 N1817S probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5559:Gm8251 UTSW 1 44058515 missense possibly damaging 0.77
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTAGCACAGGGTAGGGC -3'
(R):5'- TAGGACCATGTTCTCTGCACTC -3'

Sequencing Primer
(F):5'- AGGGCACATGGCTTTGC -3'
(R):5'- CTGCACTCACAGAGTATGGAATCTTC -3'
Posted On2014-08-01