Incidental Mutation 'R1944:Mettl8'
ID216421
Institutional Source Beutler Lab
Gene Symbol Mettl8
Ensembl Gene ENSMUSG00000041975
Gene Namemethyltransferase like 8
SynonymsTIP
MMRRC Submission 039962-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location70964561-71055583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70973279 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 268 (F268L)
Ref Sequence ENSEMBL: ENSMUSP00000115855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100037] [ENSMUST00000112179] [ENSMUST00000112186] [ENSMUST00000121586] [ENSMUST00000148876] [ENSMUST00000149181]
Predicted Effect probably damaging
Transcript: ENSMUST00000100037
AA Change: F221L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097615
Gene: ENSMUSG00000041975
AA Change: F221L

DomainStartEndE-ValueType
Pfam:Methyltransf_23 115 304 1.4e-14 PFAM
Pfam:Ubie_methyltran 126 265 1.4e-7 PFAM
Pfam:Methyltransf_31 137 304 5.6e-10 PFAM
Pfam:Methyltransf_26 140 251 4.2e-8 PFAM
Pfam:Methyltransf_25 143 246 5.3e-13 PFAM
Pfam:Methyltransf_12 144 248 1e-12 PFAM
Pfam:Methyltransf_11 144 250 7.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112179
SMART Domains Protein: ENSMUSP00000107800
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
low complexity region 190 206 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112186
AA Change: F268L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107804
Gene: ENSMUSG00000041975
AA Change: F268L

DomainStartEndE-ValueType
Pfam:Methyltransf_23 158 349 5.1e-15 PFAM
Pfam:Ubie_methyltran 173 312 8.7e-8 PFAM
Pfam:Methyltransf_31 184 348 3.7e-9 PFAM
Pfam:Methyltransf_25 190 293 3.9e-13 PFAM
Pfam:Methyltransf_12 191 295 7e-13 PFAM
Pfam:Methyltransf_11 191 297 6.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121586
AA Change: F268L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113642
Gene: ENSMUSG00000041975
AA Change: F268L

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 279 1.4e-6 PFAM
Pfam:Methyltransf_11 191 280 5.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124781
Predicted Effect unknown
Transcript: ENSMUST00000140293
AA Change: F36L
SMART Domains Protein: ENSMUSP00000118026
Gene: ENSMUSG00000041975
AA Change: F36L

DomainStartEndE-ValueType
Pfam:Methyltransf_11 2 66 2.2e-8 PFAM
Pfam:Methyltransf_23 3 109 6.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148876
AA Change: F268L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115855
Gene: ENSMUSG00000041975
AA Change: F268L

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 281 1.9e-8 PFAM
Pfam:Methyltransf_11 191 280 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149181
SMART Domains Protein: ENSMUSP00000119863
Gene: ENSMUSG00000041975

DomainStartEndE-ValueType
SCOP:d1af7_2 107 137 7e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cacna1c A G 6: 118,606,266 I1516T probably damaging Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gm8251 G A 1: 44,061,849 P30S probably damaging Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Nav3 T C 10: 109,716,530 N1817S probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Mettl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mettl8 APN 2 70982090 missense probably damaging 1.00
IGL01370:Mettl8 APN 2 70982039 missense probably damaging 1.00
R1709:Mettl8 UTSW 2 70982151 missense probably benign 0.02
R5107:Mettl8 UTSW 2 70965557 missense probably damaging 1.00
R5278:Mettl8 UTSW 2 70973297 missense probably damaging 1.00
R5629:Mettl8 UTSW 2 70965569 missense probably benign
R5864:Mettl8 UTSW 2 70982013 missense probably benign 0.10
R6272:Mettl8 UTSW 2 70976075 unclassified probably null
R6402:Mettl8 UTSW 2 70966461 nonsense probably null
R6535:Mettl8 UTSW 2 70973389 missense possibly damaging 0.73
R7181:Mettl8 UTSW 2 70973362 missense possibly damaging 0.79
R7288:Mettl8 UTSW 2 70982038 missense probably benign 0.01
X0062:Mettl8 UTSW 2 70981974 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CAGTGACAGAAAGCTCGCTAATG -3'
(R):5'- AACCCTGGAAGTCTGCTAAC -3'

Sequencing Primer
(F):5'- ACCAGTTTCTTTCTTAGAGTGTGAAG -3'
(R):5'- GGAAGTCTGCTAACTCCTGC -3'
Posted On2014-08-01