Incidental Mutation 'R1944:Cacna1c'
ID216451
Institutional Source Beutler Lab
Gene Symbol Cacna1c
Ensembl Gene ENSMUSG00000051331
Gene Namecalcium channel, voltage-dependent, L type, alpha 1C subunit
SynonymsCav1.2, D930026N18Rik, Cchl1a1, (alpha)1 subunit, L-type Cav1.2
MMRRC Submission 039962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118587240-119196418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118606266 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1516 (I1516T)
Ref Sequence ENSEMBL: ENSMUSP00000151458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075591] [ENSMUST00000078320] [ENSMUST00000112790] [ENSMUST00000112793] [ENSMUST00000112825] [ENSMUST00000185345] [ENSMUST00000186889] [ENSMUST00000187317] [ENSMUST00000187386] [ENSMUST00000187474] [ENSMUST00000187940] [ENSMUST00000188078] [ENSMUST00000188106] [ENSMUST00000188522] [ENSMUST00000188865] [ENSMUST00000189389] [ENSMUST00000189520] [ENSMUST00000190285] [ENSMUST00000219018] [ENSMUST00000219223] [ENSMUST00000219833] [ENSMUST00000220022]
Predicted Effect probably benign
Transcript: ENSMUST00000075591
AA Change: I1592T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075021
Gene: ENSMUSG00000051331
AA Change: I1592T

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 3.5e-60 PFAM
PDB:4DEY|B 246 369 2e-57 PDB
low complexity region 370 384 N/A INTRINSIC
transmembrane domain 390 409 N/A INTRINSIC
Pfam:Ion_trans 424 618 1.3e-46 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
transmembrane domain 762 784 N/A INTRINSIC
Pfam:Ion_trans 801 1031 2.6e-51 PFAM
Pfam:PKD_channel 1095 1348 2.7e-10 PFAM
Pfam:Ion_trans 1119 1341 3.9e-70 PFAM
Blast:EFh 1362 1390 4e-9 BLAST
Ca_chan_IQ 1476 1510 3.28e-15 SMART
low complexity region 1630 1640 N/A INTRINSIC
low complexity region 1810 1824 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078320
AA Change: I1592T

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077433
Gene: ENSMUSG00000051331
AA Change: I1592T

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 1.4e-59 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 5.2e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 2.5e-51 PFAM
Pfam:PKD_channel 1070 1323 1.1e-9 PFAM
Pfam:Ion_trans 1094 1316 1.5e-69 PFAM
Blast:EFh 1337 1365 4e-9 BLAST
Ca_chan_IQ 1451 1485 3.28e-15 SMART
low complexity region 1605 1615 N/A INTRINSIC
low complexity region 1785 1799 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112790
AA Change: I1592T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108410
Gene: ENSMUSG00000051331
AA Change: I1592T

DomainStartEndE-ValueType
Pfam:Ion_trans 2 245 5.7e-60 PFAM
PDB:4DEY|B 246 344 4e-63 PDB
low complexity region 345 359 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
Pfam:Ion_trans 399 593 2.1e-46 PFAM
low complexity region 608 618 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
low complexity region 686 693 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
Pfam:Ion_trans 776 1006 1e-51 PFAM
Pfam:Ion_trans 1094 1305 1.1e-66 PFAM
Pfam:PKD_channel 1140 1312 1.3e-8 PFAM
Blast:EFh 1326 1354 4e-9 BLAST
Ca_chan_IQ 1440 1474 3.28e-15 SMART
low complexity region 1594 1604 N/A INTRINSIC
low complexity region 1774 1788 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112793
AA Change: I1675T

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000108413
Gene: ENSMUSG00000051331
AA Change: I1675T

DomainStartEndE-ValueType
Pfam:Ion_trans 1 257 1.8e-64 PFAM
Pfam:PKD_channel 379 624 5.8e-8 PFAM
Pfam:Ion_trans 389 630 5e-56 PFAM
low complexity region 633 643 N/A INTRINSIC
low complexity region 663 675 N/A INTRINSIC
low complexity region 711 718 N/A INTRINSIC
Pfam:Ion_trans 765 1043 8.7e-64 PFAM
Pfam:Ion_trans 1084 1411 6.4e-69 PFAM
Pfam:PKD_channel 1234 1406 9.2e-9 PFAM
Pfam:GPHH 1413 1482 7.7e-40 PFAM
Ca_chan_IQ 1534 1568 3.28e-15 SMART
Pfam:CAC1F_C 1577 2060 3.5e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112825
AA Change: I1322T

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108444
Gene: ENSMUSG00000051331
AA Change: I1322T

DomainStartEndE-ValueType
Pfam:Ion_trans 1 140 1.8e-31 PFAM
PDB:4DEY|B 141 264 1e-54 PDB
low complexity region 265 279 N/A INTRINSIC
Pfam:Ion_trans 319 513 2e-46 PFAM
low complexity region 528 538 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 606 613 N/A INTRINSIC
Pfam:Ion_trans 659 906 1e-43 PFAM
Pfam:Ion_trans 994 1205 7.1e-70 PFAM
Pfam:PKD_channel 1041 1212 1.6e-8 PFAM
Blast:EFh 1226 1254 4e-9 BLAST
Ca_chan_IQ 1340 1374 3.28e-15 SMART
low complexity region 1494 1504 N/A INTRINSIC
low complexity region 1674 1688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185345
AA Change: I1612T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140833
Gene: ENSMUSG00000051331
AA Change: I1612T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 3e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.2e-50 PFAM
Pfam:PKD_channel 1250 1502 6.9e-9 PFAM
Pfam:Ion_trans 1273 1495 6.4e-65 PFAM
Blast:EFh 1516 1544 5e-9 BLAST
Ca_chan_IQ 1630 1664 2.5e-19 SMART
low complexity region 1784 1794 N/A INTRINSIC
low complexity region 1964 1978 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186889
AA Change: I1622T

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140056
Gene: ENSMUSG00000051331
AA Change: I1622T

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 1.5e-59 PFAM
PDB:4DEY|B 435 533 5e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 5.6e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 2.7e-51 PFAM
Pfam:PKD_channel 1261 1512 1.3e-9 PFAM
Pfam:Ion_trans 1283 1505 1.7e-69 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187317
AA Change: I1640T

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140693
Gene: ENSMUSG00000051331
AA Change: I1640T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.8e-60 PFAM
PDB:4DEY|B 405 503 2e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
transmembrane domain 931 953 N/A INTRINSIC
Pfam:Ion_trans 955 1185 2.3e-50 PFAM
Pfam:PKD_channel 1249 1530 8.3e-8 PFAM
Pfam:Ion_trans 1273 1326 5e-16 PFAM
Pfam:Ion_trans 1323 1523 2.5e-56 PFAM
Blast:EFh 1544 1572 5e-9 BLAST
Ca_chan_IQ 1658 1692 2.5e-19 SMART
low complexity region 1812 1822 N/A INTRINSIC
low complexity region 1992 2006 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187386
AA Change: I1588T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140341
Gene: ENSMUSG00000051331
AA Change: I1588T

DomainStartEndE-ValueType
transmembrane domain 96 118 N/A INTRINSIC
Pfam:Ion_trans 132 375 8.5e-60 PFAM
PDB:4DEY|B 376 499 1e-57 PDB
low complexity region 500 514 N/A INTRINSIC
transmembrane domain 520 539 N/A INTRINSIC
Pfam:Ion_trans 554 748 1.4e-44 PFAM
low complexity region 763 773 N/A INTRINSIC
low complexity region 793 805 N/A INTRINSIC
low complexity region 841 848 N/A INTRINSIC
transmembrane domain 892 914 N/A INTRINSIC
Pfam:Ion_trans 931 1161 2.9e-49 PFAM
Pfam:PKD_channel 1226 1478 6.8e-9 PFAM
Pfam:Ion_trans 1249 1471 6.3e-65 PFAM
Blast:EFh 1492 1520 4e-9 BLAST
Ca_chan_IQ 1606 1640 2.5e-19 SMART
low complexity region 1760 1770 N/A INTRINSIC
low complexity region 1940 1954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187474
AA Change: I1622T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140961
Gene: ENSMUSG00000051331
AA Change: I1622T

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1261 1512 7.3e-10 PFAM
Pfam:Ion_trans 1283 1505 8.3e-70 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000187940
AA Change: I1622T

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141033
Gene: ENSMUSG00000051331
AA Change: I1622T

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
Pfam:Ion_trans 191 434 7.6e-60 PFAM
PDB:4DEY|B 435 533 4e-63 PDB
low complexity region 534 548 N/A INTRINSIC
Pfam:Ion_trans 588 782 2.8e-46 PFAM
low complexity region 797 807 N/A INTRINSIC
low complexity region 827 839 N/A INTRINSIC
low complexity region 875 882 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
Pfam:Ion_trans 965 1195 5.6e-51 PFAM
Pfam:PKD_channel 1260 1512 5.8e-11 PFAM
Pfam:Ion_trans 1283 1505 1.2e-66 PFAM
Blast:EFh 1526 1554 5e-9 BLAST
Ca_chan_IQ 1640 1674 3.28e-15 SMART
low complexity region 1794 1804 N/A INTRINSIC
low complexity region 1974 1988 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188078
AA Change: I1592T

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140415
Gene: ENSMUSG00000051331
AA Change: I1592T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 9e-8 PFAM
Pfam:Ion_trans 1253 1475 4.3e-68 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188106
AA Change: I1606T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140886
Gene: ENSMUSG00000051331
AA Change: I1606T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-62 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-46 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-51 PFAM
Pfam:Ion_trans 1278 1489 5.2e-70 PFAM
Pfam:PKD_channel 1325 1496 4.8e-9 PFAM
Blast:EFh 1510 1538 5e-9 BLAST
Ca_chan_IQ 1624 1658 3.28e-15 SMART
low complexity region 1778 1788 N/A INTRINSIC
low complexity region 1958 1972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188181
Predicted Effect possibly damaging
Transcript: ENSMUST00000188522
AA Change: I1617T

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140920
Gene: ENSMUSG00000051331
AA Change: I1617T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 528 2e-57 PDB
low complexity region 529 543 N/A INTRINSIC
transmembrane domain 549 568 N/A INTRINSIC
Pfam:Ion_trans 583 777 1.4e-44 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 822 834 N/A INTRINSIC
low complexity region 870 877 N/A INTRINSIC
transmembrane domain 921 943 N/A INTRINSIC
Pfam:Ion_trans 960 1190 2.9e-49 PFAM
Pfam:PKD_channel 1255 1507 7e-9 PFAM
Pfam:Ion_trans 1278 1500 6.4e-65 PFAM
Blast:EFh 1521 1549 5e-9 BLAST
Ca_chan_IQ 1635 1669 2.5e-19 SMART
low complexity region 1789 1799 N/A INTRINSIC
low complexity region 1969 1983 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188865
AA Change: I1592T

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139981
Gene: ENSMUSG00000051331
AA Change: I1592T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.5e-60 PFAM
PDB:4DEY|B 405 503 5e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 6.9e-50 PFAM
Pfam:PKD_channel 1230 1482 6.8e-9 PFAM
Pfam:Ion_trans 1253 1475 6.3e-65 PFAM
Blast:EFh 1496 1524 4e-9 BLAST
Ca_chan_IQ 1610 1644 2.5e-19 SMART
low complexity region 1764 1774 N/A INTRINSIC
low complexity region 1944 1958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189389
AA Change: I1620T

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139855
Gene: ENSMUSG00000051331
AA Change: I1620T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.7e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.5e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 3e-49 PFAM
Pfam:PKD_channel 1229 1510 8.2e-8 PFAM
Pfam:Ion_trans 1253 1306 5e-16 PFAM
Pfam:Ion_trans 1303 1503 2.5e-56 PFAM
Blast:EFh 1524 1552 5e-9 BLAST
Ca_chan_IQ 1638 1672 2.5e-19 SMART
low complexity region 1792 1802 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189520
AA Change: I1609T

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140220
Gene: ENSMUSG00000051331
AA Change: I1609T

DomainStartEndE-ValueType
low complexity region 26 39 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Pfam:Ion_trans 161 404 8.6e-60 PFAM
PDB:4DEY|B 405 503 4e-63 PDB
low complexity region 504 518 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:Ion_trans 558 752 1.4e-44 PFAM
low complexity region 767 777 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
low complexity region 845 852 N/A INTRINSIC
transmembrane domain 896 918 N/A INTRINSIC
Pfam:Ion_trans 935 1165 7e-50 PFAM
Pfam:PKD_channel 1229 1499 2.2e-9 PFAM
Pfam:Ion_trans 1253 1305 6.6e-16 PFAM
Pfam:Ion_trans 1301 1492 1.1e-56 PFAM
Blast:EFh 1513 1541 5e-9 BLAST
Ca_chan_IQ 1627 1661 2.5e-19 SMART
low complexity region 1781 1791 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190285
AA Change: I1647T

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141015
Gene: ENSMUSG00000051331
AA Change: I1647T

DomainStartEndE-ValueType
low complexity region 56 69 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
Pfam:Ion_trans 191 434 4e-58 PFAM
PDB:4DEY|B 435 558 2e-57 PDB
low complexity region 559 573 N/A INTRINSIC
transmembrane domain 579 598 N/A INTRINSIC
Pfam:Ion_trans 613 807 1.5e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
low complexity region 852 864 N/A INTRINSIC
low complexity region 900 907 N/A INTRINSIC
transmembrane domain 951 973 N/A INTRINSIC
Pfam:Ion_trans 990 1220 3e-49 PFAM
Pfam:PKD_channel 1285 1537 1.4e-7 PFAM
Pfam:Ion_trans 1308 1530 4.4e-68 PFAM
Blast:EFh 1551 1579 5e-9 BLAST
Ca_chan_IQ 1665 1699 2.5e-19 SMART
low complexity region 1819 1829 N/A INTRINSIC
low complexity region 1999 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219018
AA Change: I1433T

PolyPhen 2 Score 0.302 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000219223
AA Change: I1422T

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219833
AA Change: I1458T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000220022
AA Change: I1516T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1 subunit of a voltage-dependent calcium channel. Calcium channels mediate the influx of calcium ions into the cell upon membrane polarization. The alpha-1 subunit consists of 24 transmembrane segments and forms the pore through which ions pass into the cell. The calcium channel consists of a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. There are multiple isoforms of each of these proteins, either encoded by different genes or the result of alternative splicing of transcripts. The protein encoded by this gene binds to and is inhibited by dihydropyridine. Alternative splicing results in many transcript variants encoding different proteins. Some of the predicted proteins may not produce functional ion channel subunits. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for mutations that inactivate the gene do not survive to term. Selective ablation in beta cells resulted in impaired insulin secretion and systemic glucose intolerance. Heterozygotes were hypoactive, showed increased anxiety, and poor motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gm8251 G A 1: 44,061,849 P30S probably damaging Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Mettl8 A T 2: 70,973,279 F268L probably damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Nav3 T C 10: 109,716,530 N1817S probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Cacna1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cacna1c APN 6 118676444 splice site probably benign
IGL00990:Cacna1c APN 6 118613295 missense probably damaging 1.00
IGL01352:Cacna1c APN 6 118656557 nonsense probably null
IGL01922:Cacna1c APN 6 118652668 missense probably damaging 0.99
IGL02008:Cacna1c APN 6 118715924 missense probably null 0.25
IGL02049:Cacna1c APN 6 118603919 missense probably benign 0.34
IGL02320:Cacna1c APN 6 118637792 missense probably damaging 1.00
IGL02375:Cacna1c APN 6 118675923 missense probably damaging 1.00
IGL02454:Cacna1c APN 6 118602180 missense probably damaging 1.00
IGL02544:Cacna1c APN 6 118751479 missense probably damaging 1.00
IGL02648:Cacna1c APN 6 118757496 missense probably damaging 1.00
IGL03191:Cacna1c APN 6 118741903 missense probably damaging 1.00
PIT4418001:Cacna1c UTSW 6 118654423 missense
PIT4469001:Cacna1c UTSW 6 118595972 missense unknown
R0041:Cacna1c UTSW 6 118594027 missense probably damaging 0.99
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0062:Cacna1c UTSW 6 118602237 missense probably damaging 1.00
R0083:Cacna1c UTSW 6 118625523 missense probably damaging 1.00
R0131:Cacna1c UTSW 6 118625512 missense probably damaging 1.00
R0142:Cacna1c UTSW 6 118603882 missense probably damaging 1.00
R0193:Cacna1c UTSW 6 118602402 splice site probably benign
R0245:Cacna1c UTSW 6 118604454 missense probably benign 0.10
R0394:Cacna1c UTSW 6 118625497 missense probably damaging 1.00
R0555:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0617:Cacna1c UTSW 6 118602213 missense probably damaging 1.00
R0652:Cacna1c UTSW 6 118602229 missense probably damaging 1.00
R0730:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0812:Cacna1c UTSW 6 118630263 missense probably benign 0.07
R0828:Cacna1c UTSW 6 118757386 missense probably benign 0.24
R0837:Cacna1c UTSW 6 118630270 nonsense probably null
R0881:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0882:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R0924:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R0930:Cacna1c UTSW 6 118675896 missense probably damaging 1.00
R1157:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1158:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1159:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1160:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1237:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1238:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1239:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1337:Cacna1c UTSW 6 118627455 missense probably damaging 1.00
R1433:Cacna1c UTSW 6 118652793 nonsense probably null
R1463:Cacna1c UTSW 6 118593994 missense probably benign 0.27
R1517:Cacna1c UTSW 6 118598759 missense probably benign 0.01
R1619:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1704:Cacna1c UTSW 6 118602146 missense probably benign 0.01
R1739:Cacna1c UTSW 6 118610544 missense probably damaging 0.99
R1804:Cacna1c UTSW 6 118687046 missense probably damaging 1.00
R1889:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1891:Cacna1c UTSW 6 118776519 missense probably damaging 1.00
R1895:Cacna1c UTSW 6 118612625 missense probably damaging 1.00
R1961:Cacna1c UTSW 6 118630322 missense probably benign 0.05
R2043:Cacna1c UTSW 6 118596088 missense probably benign 0.01
R2045:Cacna1c UTSW 6 118656137 missense probably damaging 1.00
R2217:Cacna1c UTSW 6 118670407 missense probably damaging 1.00
R2237:Cacna1c UTSW 6 118652743 missense possibly damaging 0.94
R2509:Cacna1c UTSW 6 118734982 missense probably damaging 1.00
R3157:Cacna1c UTSW 6 118751524 missense probably benign 0.00
R3739:Cacna1c UTSW 6 118741952 missense probably benign
R3831:Cacna1c UTSW 6 118604463 missense probably benign 0.06
R4319:Cacna1c UTSW 6 118654369 missense probably damaging 1.00
R4477:Cacna1c UTSW 6 118630239 missense possibly damaging 0.48
R4571:Cacna1c UTSW 6 118630380 missense probably benign
R4671:Cacna1c UTSW 6 118652058 missense probably damaging 1.00
R4729:Cacna1c UTSW 6 118656175 missense probably damaging 1.00
R4741:Cacna1c UTSW 6 118613310 missense probably damaging 1.00
R4798:Cacna1c UTSW 6 118630302 nonsense probably null
R4803:Cacna1c UTSW 6 118751541 missense probably damaging 0.99
R4821:Cacna1c UTSW 6 118696425 missense probably damaging 1.00
R4888:Cacna1c UTSW 6 118751439 missense probably damaging 1.00
R4981:Cacna1c UTSW 6 118751471 missense probably benign 0.00
R5253:Cacna1c UTSW 6 118597969 missense probably benign 0.01
R5297:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5345:Cacna1c UTSW 6 118656536 critical splice donor site probably null
R5364:Cacna1c UTSW 6 118656543 missense probably benign 0.35
R5439:Cacna1c UTSW 6 118654372 missense probably damaging 1.00
R5472:Cacna1c UTSW 6 118638446 missense possibly damaging 0.86
R5516:Cacna1c UTSW 6 119057218 missense probably damaging 1.00
R5590:Cacna1c UTSW 6 118687182 missense probably damaging 1.00
R5619:Cacna1c UTSW 6 118742361 missense probably damaging 1.00
R5684:Cacna1c UTSW 6 118687044 missense probably damaging 1.00
R5737:Cacna1c UTSW 6 118741932 missense probably damaging 1.00
R5768:Cacna1c UTSW 6 118697680 missense probably damaging 1.00
R5933:Cacna1c UTSW 6 118612580 missense probably damaging 1.00
R5965:Cacna1c UTSW 6 118602300 missense probably damaging 1.00
R6114:Cacna1c UTSW 6 118596140 missense probably benign 0.07
R6161:Cacna1c UTSW 6 119057302 missense probably damaging 1.00
R6267:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6267:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6296:Cacna1c UTSW 6 118598723 missense possibly damaging 0.52
R6296:Cacna1c UTSW 6 118652714 missense probably benign 0.09
R6307:Cacna1c UTSW 6 118613953 missense probably damaging 0.97
R6431:Cacna1c UTSW 6 118751373 missense probably damaging 1.00
R6467:Cacna1c UTSW 6 118652710 missense probably damaging 1.00
R7026:Cacna1c UTSW 6 118637771 missense probably damaging 1.00
R7049:Cacna1c UTSW 6 118601163 missense probably benign 0.35
R7072:Cacna1c UTSW 6 118596106 missense
R7192:Cacna1c UTSW 6 118656249 missense
R7243:Cacna1c UTSW 6 118637729 critical splice donor site probably null
R7250:Cacna1c UTSW 6 118598005 missense
R7250:Cacna1c UTSW 6 118696451 missense
R7264:Cacna1c UTSW 6 118602195 missense
R7312:Cacna1c UTSW 6 119057211 missense
R7392:Cacna1c UTSW 6 118741920 missense
R7401:Cacna1c UTSW 6 119052708 critical splice acceptor site probably null
X0065:Cacna1c UTSW 6 118657376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAGCAGGGGAGACTC -3'
(R):5'- CTGGCTTGCATGGAAGGAGG -3'

Sequencing Primer
(F):5'- GCAGGGGAGACTCAAGTACG -3'
(R):5'- AATGGCCTTGAACAGGGG -3'
Posted On2014-08-01