Incidental Mutation 'R1944:Npc1l1'
ID216480
Institutional Source Beutler Lab
Gene Symbol Npc1l1
Ensembl Gene ENSMUSG00000020447
Gene NameNPC1 like intracellular cholesterol transporter 1
Synonyms9130221N23Rik, Niemann-Pick disease, type C1
MMRRC Submission 039962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location6211013-6230143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6214588 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1154 (I1154F)
Ref Sequence ENSEMBL: ENSMUSP00000004505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004505
AA Change: I1154F

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000004505
Gene: ENSMUSG00000020447
AA Change: I1154F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:NPC1_N 28 283 8.7e-74 PFAM
low complexity region 294 307 N/A INTRINSIC
transmembrane domain 348 370 N/A INTRINSIC
Pfam:Patched 385 897 4.7e-52 PFAM
Pfam:Sterol-sensing 661 815 5.7e-55 PFAM
Pfam:MMPL 665 830 2.3e-11 PFAM
Pfam:Patched 1063 1268 6.2e-34 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a multi-pass membrane protein. It contains a conserved N-terminal Niemann-Pick C1 (NPC1) domain and a putative sterol-sensing domain (SSD) which includes a YQRL motif functioning as a plasma membrane to trans-Golgi network transport signal in other proteins. This protein takes up free cholesterol into cells through vesicular endocytosis and plays a critical role in the absorption of intestinal cholesterol. It also has the ability to transport alpha-tocopherol (vitamin E). The drug ezetimibe targets this protein and inhibits the absorption of intestinal cholesterol and alpha-tocopherol. In addition, this protein may play a critical role in regulating lipid metabolism. Polymorphic variations in this gene are associated with plasma total cholesterol and low-density lipoprotein cholesterol (LDL-C) levels and coronary heart disease (CHD) risk. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit normal intestinal development, fertility and plasma cholesterol and triglyceride levels; however, intestinal cholesterol absorption was substantially reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cacna1c A G 6: 118,606,266 I1516T probably damaging Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gm8251 G A 1: 44,061,849 P30S probably damaging Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt32 T A 11: 100,084,844 probably null Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Mettl8 A T 2: 70,973,279 F268L probably damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Nav3 T C 10: 109,716,530 N1817S probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Npc1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Npc1l1 APN 11 6224199 missense probably damaging 1.00
IGL01348:Npc1l1 APN 11 6227974 missense probably damaging 1.00
IGL01891:Npc1l1 APN 11 6214280 missense probably damaging 1.00
IGL01897:Npc1l1 APN 11 6227879 missense probably benign
IGL02098:Npc1l1 APN 11 6214581 missense probably damaging 0.99
IGL02121:Npc1l1 APN 11 6228157 missense probably benign
IGL02724:Npc1l1 APN 11 6214684 missense possibly damaging 0.88
IGL02947:Npc1l1 APN 11 6229246 missense probably benign 0.01
IGL03328:Npc1l1 APN 11 6218643 nonsense probably null
R0137:Npc1l1 UTSW 11 6228148 nonsense probably null
R0322:Npc1l1 UTSW 11 6229042 missense probably benign
R0352:Npc1l1 UTSW 11 6223076 missense probably benign 0.00
R0492:Npc1l1 UTSW 11 6223040 missense possibly damaging 0.82
R0918:Npc1l1 UTSW 11 6218239 missense probably damaging 1.00
R1300:Npc1l1 UTSW 11 6227859 missense probably damaging 1.00
R1455:Npc1l1 UTSW 11 6228174 missense possibly damaging 0.66
R1588:Npc1l1 UTSW 11 6217785 missense probably benign 0.01
R1803:Npc1l1 UTSW 11 6228846 missense probably damaging 1.00
R1882:Npc1l1 UTSW 11 6217473 splice site probably null
R1945:Npc1l1 UTSW 11 6214588 missense possibly damaging 0.67
R1945:Npc1l1 UTSW 11 6225199 nonsense probably null
R3155:Npc1l1 UTSW 11 6221840 missense probably benign
R4343:Npc1l1 UTSW 11 6217773 missense probably benign
R4504:Npc1l1 UTSW 11 6228741 missense possibly damaging 0.61
R4610:Npc1l1 UTSW 11 6228215 missense probably damaging 1.00
R4807:Npc1l1 UTSW 11 6218723 missense probably damaging 1.00
R4829:Npc1l1 UTSW 11 6214010 critical splice donor site probably null
R5135:Npc1l1 UTSW 11 6224245 missense possibly damaging 0.94
R5290:Npc1l1 UTSW 11 6222221 missense probably benign 0.00
R5369:Npc1l1 UTSW 11 6217705 critical splice donor site probably null
R5388:Npc1l1 UTSW 11 6214733 missense probably damaging 1.00
R5532:Npc1l1 UTSW 11 6224245 missense probably damaging 0.98
R5540:Npc1l1 UTSW 11 6214546 missense probably damaging 1.00
R5754:Npc1l1 UTSW 11 6227839 missense probably damaging 1.00
R5760:Npc1l1 UTSW 11 6229031 missense probably benign 0.02
R6057:Npc1l1 UTSW 11 6217806 missense possibly damaging 0.66
R6388:Npc1l1 UTSW 11 6224145 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214013 missense probably damaging 1.00
R6644:Npc1l1 UTSW 11 6214014 missense probably damaging 0.98
R6756:Npc1l1 UTSW 11 6215153 missense probably damaging 1.00
R6790:Npc1l1 UTSW 11 6214260 splice site probably null
R7006:Npc1l1 UTSW 11 6217731 missense probably benign
R7062:Npc1l1 UTSW 11 6217807 missense probably benign
R7273:Npc1l1 UTSW 11 6218320 missense probably damaging 1.00
R7383:Npc1l1 UTSW 11 6217777 missense probably benign 0.30
X0022:Npc1l1 UTSW 11 6228058 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTACAGGCAAGAGAAATGAACTTC -3'
(R):5'- ACACCCTGATCTTTGGCAGG -3'

Sequencing Primer
(F):5'- GCAAGAGAAATGAACTTCAGGAAAC -3'
(R):5'- AGGATCTCCAATGTGTTCTACCAG -3'
Posted On2014-08-01