Incidental Mutation 'R1944:Krt32'
ID216496
Institutional Source Beutler Lab
Gene Symbol Krt32
Ensembl Gene ENSMUSG00000046095
Gene Namekeratin 32
SynonymsmHa2, Krt1-2
MMRRC Submission 039962-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1944 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100080848-100088226 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 100084844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107419]
Predicted Effect probably null
Transcript: ENSMUST00000107419
SMART Domains Protein: ENSMUSP00000103042
Gene: ENSMUSG00000046095

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Filament 100 411 5.4e-150 SMART
low complexity region 435 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139873
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,930,796 N593Y probably damaging Het
Adamts16 C T 13: 70,791,886 S406N possibly damaging Het
Adgrg1 G A 8: 95,007,300 V350I probably damaging Het
Adgrv1 A T 13: 81,510,911 D2051E probably damaging Het
Adrb2 C A 18: 62,179,413 V114L probably damaging Het
Ago3 A G 4: 126,353,727 V599A probably damaging Het
AI837181 T C 19: 5,426,229 V140A probably damaging Het
Ankrd16 T A 2: 11,783,632 probably null Het
Arnt2 A G 7: 84,343,751 S194P probably benign Het
Art2b T C 7: 101,579,946 N249D probably benign Het
Atat1 A G 17: 35,909,340 L60P probably damaging Het
Atp2b1 A T 10: 99,022,931 I1159F probably damaging Het
Atrip T A 9: 109,071,867 I135F probably damaging Het
Bbs4 T G 9: 59,330,415 probably null Het
Bdp1 A T 13: 100,074,381 probably null Het
Best2 A G 8: 85,010,761 probably null Het
Cacna1c A G 6: 118,606,266 I1516T probably damaging Het
Cadps2 T C 6: 23,599,480 I276V probably damaging Het
Carmil3 T C 14: 55,498,630 S610P probably damaging Het
Caskin1 A G 17: 24,500,771 I375V probably damaging Het
Ccdc92b A G 11: 74,630,009 I46V probably benign Het
Clec11a G T 7: 44,304,674 T285K probably benign Het
Clk3 G T 9: 57,765,186 T111K probably benign Het
Col6a6 G A 9: 105,709,384 R1813C probably damaging Het
Col7a1 G A 9: 108,960,010 V798I unknown Het
Ctrb1 C A 8: 111,689,519 W45L probably damaging Het
Cubn T A 2: 13,278,538 S3530C probably benign Het
Dio1 A G 4: 107,306,780 probably null Het
Dock5 A T 14: 67,757,135 Y1825* probably null Het
Duox1 A T 2: 122,346,520 Q1476L probably damaging Het
Dync2h1 A T 9: 7,001,377 H3877Q probably damaging Het
Enkd1 A G 8: 105,707,576 S85P probably damaging Het
Erap1 A G 13: 74,646,639 D139G probably benign Het
Ern1 A G 11: 106,421,950 S202P probably damaging Het
F11r T C 1: 171,461,891 Y261H probably damaging Het
Fam129a T C 1: 151,696,228 I308T probably damaging Het
Glp2r A T 11: 67,746,792 S138T probably benign Het
Gm11127 A G 17: 36,058,005 F61S probably damaging Het
Gm765 A G 6: 98,248,190 I44T probably benign Het
Gm8251 G A 1: 44,061,849 P30S probably damaging Het
Gpt2 A G 8: 85,517,996 Y306C probably damaging Het
Grid2 G C 6: 63,909,061 R147P probably damaging Het
Gtdc1 A G 2: 44,752,186 F128L possibly damaging Het
Hacd4 T C 4: 88,423,066 T154A possibly damaging Het
Heatr6 G T 11: 83,769,220 L530F probably damaging Het
Hoxd8 A T 2: 74,706,712 D256V probably damaging Het
Ints6 T C 14: 62,693,640 N865D probably benign Het
Itpkc G T 7: 27,227,659 P277T possibly damaging Het
Klc4 T C 17: 46,636,627 N383S probably damaging Het
Klra6 T C 6: 130,018,945 Y150C possibly damaging Het
Krt33a T C 11: 100,012,709 N199S probably benign Het
Krt39 A C 11: 99,519,823 D174E probably damaging Het
Krt82 G A 15: 101,548,535 R137W probably damaging Het
Lgmn A T 12: 102,401,924 S193T probably damaging Het
Limch1 G A 5: 66,999,099 R300H probably damaging Het
Lrpap1 T A 5: 35,097,630 I221F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Macf1 T C 4: 123,370,666 D4883G probably damaging Het
Man2b2 A G 5: 36,816,180 V485A probably benign Het
Map3k19 T C 1: 127,823,122 T831A probably benign Het
Megf6 C G 4: 154,256,066 D471E possibly damaging Het
Mettl8 A T 2: 70,973,279 F268L probably damaging Het
Miip T C 4: 147,865,965 E58G probably benign Het
Mycbp2 T A 14: 103,229,404 S1308C probably damaging Het
Myo15 T C 11: 60,502,083 F2194L probably damaging Het
Nav3 T C 10: 109,716,530 N1817S probably damaging Het
Ndel1 A T 11: 68,829,920 H313Q probably benign Het
Neb A T 2: 52,228,850 H3931Q probably benign Het
Nfkb2 T A 19: 46,308,052 V253E probably damaging Het
Nono T C X: 101,441,823 probably null Het
Npc1l1 T A 11: 6,214,588 I1154F possibly damaging Het
Nr2e1 T C 10: 42,572,778 T155A probably benign Het
Olfr1359 A T 13: 21,703,117 I39F possibly damaging Het
Oosp2 C T 19: 11,649,595 probably null Het
Pdap1 G A 5: 145,132,916 T93I probably benign Het
Pde6c T A 19: 38,157,519 D418E probably damaging Het
Pdha1 T A X: 160,127,358 D255V probably damaging Het
Polr2h T A 16: 20,719,046 D64E probably benign Het
Psmb3 T C 11: 97,711,155 F117S probably benign Het
Ptprq A T 10: 107,582,388 M1709K probably benign Het
Rbm15 C T 3: 107,331,552 R510H probably damaging Het
Rgs7 A T 1: 175,153,203 M85K possibly damaging Het
Rpl27-ps3 T A 18: 6,332,669 V13D probably damaging Het
Rtp2 T A 16: 23,927,566 D105V possibly damaging Het
Scd3 T C 19: 44,235,780 Y151H probably benign Het
Slc30a6 T G 17: 74,408,863 V106G probably damaging Het
Slco1a4 T C 6: 141,839,550 I105V probably benign Het
Sun3 T C 11: 9,038,296 I9V probably benign Het
Syne2 T C 12: 76,074,544 V5928A probably damaging Het
Tbr1 T A 2: 61,812,256 S622T probably damaging Het
Tgm3 A G 2: 130,029,969 N306D probably damaging Het
Tmem132d A G 5: 127,783,764 *1098Q probably null Het
Tmem140 T C 6: 34,872,812 Y88H probably damaging Het
Trim60 A T 8: 65,001,312 V95E possibly damaging Het
Vamp3 A G 4: 151,056,160 probably null Het
Vmn1r235 A C 17: 21,261,523 T37P probably damaging Het
Vmn2r81 T G 10: 79,293,737 L821V probably damaging Het
Vmn2r97 A G 17: 18,940,238 D545G probably benign Het
Vps13c A T 9: 67,886,276 D437V probably damaging Het
Wtip A T 7: 34,118,938 M268K probably benign Het
Zfhx2 G T 14: 55,074,732 F168L probably benign Het
Zscan22 G A 7: 12,903,840 R53K probably damaging Het
Other mutations in Krt32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Krt32 APN 11 100087779 missense probably benign 0.23
IGL01454:Krt32 APN 11 100084081 missense probably damaging 1.00
IGL02268:Krt32 APN 11 100088141 missense probably benign 0.21
IGL02502:Krt32 APN 11 100087923 missense probably damaging 1.00
IGL02967:Krt32 APN 11 100084050 missense possibly damaging 0.93
IGL02799:Krt32 UTSW 11 100087907 missense possibly damaging 0.54
R0840:Krt32 UTSW 11 100081242 missense probably benign 0.00
R1503:Krt32 UTSW 11 100084110 critical splice acceptor site probably null
R1945:Krt32 UTSW 11 100084844 critical splice acceptor site probably null
R2426:Krt32 UTSW 11 100086366 missense possibly damaging 0.76
R3774:Krt32 UTSW 11 100088121 missense probably benign 0.00
R3775:Krt32 UTSW 11 100088121 missense probably benign 0.00
R3776:Krt32 UTSW 11 100088121 missense probably benign 0.00
R5522:Krt32 UTSW 11 100086671 critical splice donor site probably null
R5794:Krt32 UTSW 11 100084986 missense probably damaging 0.99
R6109:Krt32 UTSW 11 100087965 missense probably benign 0.01
R6994:Krt32 UTSW 11 100086445 missense probably damaging 1.00
Z1088:Krt32 UTSW 11 100088216 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCTTTCCTGGATCCAGTG -3'
(R):5'- ACCGCCTTAACATTGAGGTAGATG -3'

Sequencing Primer
(F):5'- TGGATCCAGTGCCCACCATC -3'
(R):5'- ACATTGAGGTAGATGCTGCACCTC -3'
Posted On2014-08-01